Classes

Class	Line #	Total Statements	Complexity	Uncovered Elements	TOTAL Coverage	Actions
ExonerateHelperTest	51	126	7	0	1.0100%	Show methods

Class ExonerateHelperTest

Class ExonerateHelperTest	Line # 51	Total Statements 126	Complexity 7	Uncovered Elements 0	TOTAL Coverage 1.0100%
setUpJvOptionPane() : void   setUpJvOptionPane() : void	5454	2.02	1.01	0.00	1.0 1.0100%
testGetMappingType() : void   testGetMappingType() : void	6161	7.07	1.01	0.00	1.0 1.0100%
testProcessGffSimilarity_protein2dna_forward_querygff() : void   testProcessGffSimilarity_protein2dna_forward_querygff() : void	9191	22.022	1.01	0.00	1.0 1.0100%
testProcessGffSimilarity_protein2dna_reverse_querygff() : void   testProcessGffSimilarity_protein2dna_reverse_querygff() : void	134134	22.022	1.01	0.00	1.0 1.0100%
testProcessGffSimilarity_protein2dna_forward_targetgff() : void   testProcessGffSimilarity_protein2dna_forward_targetgff() : void	177177	22.022	1.01	0.00	1.0 1.0100%
testProcessGffSimilarity_protein2dna_reverse_targetgff() : void   testProcessGffSimilarity_protein2dna_reverse_targetgff() : void	223223	22.022	1.01	0.00	1.0 1.0100%
testAddExonerateGffToAlignment() : void   testAddExonerateGffToAlignment() : void	266266	29.029	1.01	0.00	1.0 1.0100%

 

Contributing tests

Contributing tests

Select all

	Test contribution	Test	Result	Actions
	0.22556391	jalview.io.gff.ExonerateHelperTest.testAddExonerateGffToAlignmentjalview.io.gff.ExonerateHelperTest.testAddExonerateGffToAlignment	1PASS
	0.17293233	jalview.io.gff.ExonerateHelperTest.testProcessGffSimilarity_protein2dna_reverse_querygffjalview.io.gff.ExonerateHelperTest.testProcessGffSimilarity_protein2dna_reverse_querygff	1PASS
	0.17293233	jalview.io.gff.ExonerateHelperTest.testProcessGffSimilarity_protein2dna_forward_querygffjalview.io.gff.ExonerateHelperTest.testProcessGffSimilarity_protein2dna_forward_querygff	1PASS
	0.17293233	jalview.io.gff.ExonerateHelperTest.testProcessGffSimilarity_protein2dna_forward_targetgffjalview.io.gff.ExonerateHelperTest.testProcessGffSimilarity_protein2dna_forward_targetgff	1PASS
	0.17293233	jalview.io.gff.ExonerateHelperTest.testProcessGffSimilarity_protein2dna_reverse_targetgffjalview.io.gff.ExonerateHelperTest.testProcessGffSimilarity_protein2dna_reverse_targetgff	1PASS
	0.060150377	jalview.io.gff.ExonerateHelperTest.testGetMappingTypejalview.io.gff.ExonerateHelperTest.testGetMappingType	1PASS

 

Source view

1		/*
2		* Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
3		* Copyright (C) $$Year-Rel$$ The Jalview Authors
4		*
5		* This file is part of Jalview.
6		*
7		* Jalview is free software: you can redistribute it and/or
8		* modify it under the terms of the GNU General Public License
9		* as published by the Free Software Foundation, either version 3
10		* of the License, or (at your option) any later version.
11		*
12		* Jalview is distributed in the hope that it will be useful, but
13		* WITHOUT ANY WARRANTY; without even the implied warranty
14		* of MERCHANTABILITY or FITNESS FOR A PARTICULAR
15		* PURPOSE. See the GNU General Public License for more details.
16		*
17		* You should have received a copy of the GNU General Public License
18		* along with Jalview. If not, see <http://www.gnu.org/licenses/>.
19		* The Jalview Authors are detailed in the 'AUTHORS' file.
20		*/
21		package jalview.io.gff;
22
23		import static org.testng.AssertJUnit.assertEquals;
24		import static org.testng.AssertJUnit.assertNull;
25		import static org.testng.AssertJUnit.assertSame;
26		import static org.testng.AssertJUnit.assertTrue;
27		import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals;
28
29		import jalview.datamodel.AlignedCodonFrame;
30		import jalview.datamodel.Alignment;
31		import jalview.datamodel.AlignmentI;
32		import jalview.datamodel.Mapping;
33		import jalview.datamodel.MappingType;
34		import jalview.datamodel.Sequence;
35		import jalview.datamodel.SequenceDummy;
36		import jalview.datamodel.SequenceI;
37		import jalview.gui.AlignFrame;
38		import jalview.gui.JvOptionPane;
39		import jalview.io.DataSourceType;
40		import jalview.io.FileLoader;
41
42		import java.io.IOException;
43		import java.util.ArrayList;
44		import java.util.Iterator;
45		import java.util.List;
46		import java.util.Map;
47
48		import org.testng.annotations.BeforeClass;
49		import org.testng.annotations.Test;
50
		100% Uncovered Elements: 0 (133) Complexity: 7 Complexity Density: 0.06
51		public class ExonerateHelperTest
52		{
53
		100% Uncovered Elements: 0 (2) Complexity: 1 Complexity Density: 0.5
54	1	@BeforeClass(alwaysRun = true)...
55		public void setUpJvOptionPane()
56		{
57	1	JvOptionPane.setInteractiveMode(false);
58	1	JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION);
59		}
60
		100% Uncovered Elements: 0 (7) Complexity: 1 Complexity Density: 0.14 1PASS
61	1	@Test(groups = "Functional")...
62		public void testGetMappingType()
63		{
64		// protein-to-dna:
65	1	assertSame(MappingType.PeptideToNucleotide,
66		ExonerateHelper
67		.getMappingType("exonerate:protein2genome:local"));
68	1	assertSame(MappingType.PeptideToNucleotide,
69		ExonerateHelper.getMappingType("exonerate:protein2dna:local"));
70
71		// dna-to-dna:
72	1	assertSame(MappingType.NucleotideToNucleotide,
73		ExonerateHelper.getMappingType("coding2coding"));
74	1	assertSame(MappingType.NucleotideToNucleotide,
75		ExonerateHelper.getMappingType("coding2genome"));
76	1	assertSame(MappingType.NucleotideToNucleotide,
77		ExonerateHelper.getMappingType("cdna2genome"));
78	1	assertSame(MappingType.NucleotideToNucleotide,
79		ExonerateHelper.getMappingType("genome2genome"));
80	1	assertNull(ExonerateHelper.getMappingType("affine:local"));
81		}
82
83		/**
84		* Test processing one exonerate GFF line for the case where the mapping is
85		* protein2dna, similarity feature is on the query (the protein), match to the
86		* forward strand, target sequence is in neither the alignment nor the 'new
87		* sequences'
88		*
89		* @throws IOException
90		*/
		100% Uncovered Elements: 0 (22) Complexity: 1 Complexity Density: 0.05 1PASS
91	1	@Test(groups = "Functional")...
92		public void testProcessGffSimilarity_protein2dna_forward_querygff()
93		throws IOException
94		{
95	1	ExonerateHelper testee = new ExonerateHelper();
96	1	List<SequenceI> newseqs = new ArrayList<SequenceI>();
97	1	String[] gff = "Seq\texonerate:protein2dna:local\tsimilarity\t3\t10\t.\t+\t.\talignment_id 0 ; Target dna1 ; Align 3 400 8"
98		.split("\\t");
99	1	SequenceI seq = new Sequence("Seq", "PQRASTGKEEDVMIWCHQN");
100	1	seq.createDatasetSequence();
101	1	AlignmentI align = new Alignment(new SequenceI[] {});
102	1	Map<String, List<String>> set = Gff2Helper.parseNameValuePairs(gff[8]);
103
104		/*
105		* this should create a mapping from Seq2/3-10 to virtual sequence
106		* dna1 (added to newseqs) positions 400-423
107		*/
108	1	testee.processGffSimilarity(set, seq, gff, align, newseqs, false);
109	1	assertEquals(1, newseqs.size());
110	1	assertTrue(newseqs.get(0) instanceof SequenceDummy);
111	1	assertEquals("dna1", newseqs.get(0).getName());
112	1	assertEquals(1, align.getCodonFrames().size());
113	1	AlignedCodonFrame mapping = align.getCodonFrames().iterator().next();
114	1	assertEquals(1, mapping.getAaSeqs().length);
115	1	assertSame(seq.getDatasetSequence(), mapping.getAaSeqs()[0]);
116	1	assertEquals(1, mapping.getdnaSeqs().length);
117	1	assertSame(newseqs.get(0), mapping.getdnaSeqs()[0]);
118	1	assertEquals(1, mapping.getdnaToProt().length);
119	1	assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size());
120	1	assertArrayEquals(new int[] { 400, 423 }, mapping.getdnaToProt()[0]
121		.getFromRanges().get(0));
122	1	assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
123	1	assertArrayEquals(new int[] { 3, 10 }, mapping.getdnaToProt()[0]
124		.getToRanges().get(0));
125		}
126
127		/**
128		* Test processing one exonerate GFF line for the case where the mapping is
129		* protein2dna, similarity feature is on the query (the protein), match to the
130		* reverse strand
131		*
132		* @throws IOException
133		*/
		100% Uncovered Elements: 0 (22) Complexity: 1 Complexity Density: 0.05 1PASS
134	1	@Test(groups = "Functional")...
135		public void testProcessGffSimilarity_protein2dna_reverse_querygff()
136		throws IOException
137		{
138	1	ExonerateHelper testee = new ExonerateHelper();
139	1	List<SequenceI> newseqs = new ArrayList<SequenceI>();
140	1	String[] gff = "Seq\texonerate:protein2dna:local\tsimilarity\t3\t10\t0\t-\t.\talignment_id 0 ; Target dna1 ; Align 3 400 8"
141		.split("\\t");
142	1	SequenceI seq = new Sequence("Seq", "PQRASTGKEEDVMIWCHQN");
143	1	seq.createDatasetSequence();
144	1	AlignmentI align = new Alignment(new SequenceI[] {});
145	1	Map<String, List<String>> set = Gff2Helper.parseNameValuePairs(gff[8]);
146
147		/*
148		* this should create a mapping from Seq2/3-10 to virtual sequence
149		* dna1 (added to newseqs) positions 400-377 (reverse)
150		*/
151	1	testee.processGffSimilarity(set, seq, gff, align, newseqs, false);
152	1	assertEquals(1, newseqs.size());
153	1	assertTrue(newseqs.get(0) instanceof SequenceDummy);
154	1	assertEquals("dna1", newseqs.get(0).getName());
155	1	assertEquals(1, align.getCodonFrames().size());
156	1	AlignedCodonFrame mapping = align.getCodonFrames().iterator().next();
157	1	assertEquals(1, mapping.getAaSeqs().length);
158	1	assertSame(seq.getDatasetSequence(), mapping.getAaSeqs()[0]);
159	1	assertEquals(1, mapping.getdnaSeqs().length);
160	1	assertSame(newseqs.get(0), mapping.getdnaSeqs()[0]);
161	1	assertEquals(1, mapping.getdnaToProt().length);
162	1	assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size());
163	1	assertArrayEquals(new int[] { 400, 377 }, mapping.getdnaToProt()[0]
164		.getFromRanges().get(0));
165	1	assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
166	1	assertArrayEquals(new int[] { 3, 10 }, mapping.getdnaToProt()[0]
167		.getToRanges().get(0));
168		}
169
170		/**
171		* Test processing one exonerate GFF line for the case where the mapping is
172		* protein2dna, similarity feature is on the target (the dna), match to the
173		* forward strand
174		*
175		* @throws IOException
176		*/
		100% Uncovered Elements: 0 (22) Complexity: 1 Complexity Density: 0.05 1PASS
177	1	@Test(groups = "Functional")...
178		public void testProcessGffSimilarity_protein2dna_forward_targetgff()
179		throws IOException
180		{
181	1	ExonerateHelper testee = new ExonerateHelper();
182	1	List<SequenceI> newseqs = new ArrayList<SequenceI>();
183	1	String[] gff = "dna1\texonerate:protein2dna:local\tsimilarity\t400\t423\t0\t+\t.\talignment_id 0 ; Query Prot1 ; Align 400 3 24"
184		.split("\\t");
185	1	SequenceI seq = new Sequence("dna1/391-430",
186		"CGATCCGATCCGATCCGATCCGATCCGATCCGATCCGATC");
187	1	seq.createDatasetSequence();
188	1	AlignmentI align = new Alignment(new SequenceI[] { seq });
189		// GFF feature on the target describes mapping from base 400 for
190		// count 24 to position 3
191	1	Map<String, List<String>> set = Gff2Helper.parseNameValuePairs(gff[8]);
192
193		/*
194		* this should create a mapping from virtual sequence dna1 (added to
195		* newseqs) positions 400-423 to Prot1/3-10
196		*/
197	1	testee.processGffSimilarity(set, seq, gff, align, newseqs, false);
198	1	assertEquals(1, newseqs.size());
199	1	assertTrue(newseqs.get(0) instanceof SequenceDummy);
200	1	assertEquals("Prot1", newseqs.get(0).getName());
201	1	assertEquals(1, align.getCodonFrames().size());
202	1	AlignedCodonFrame mapping = align.getCodonFrames().iterator().next();
203	1	assertEquals(1, mapping.getAaSeqs().length);
204	1	assertSame(newseqs.get(0), mapping.getAaSeqs()[0]);
205	1	assertSame(seq.getDatasetSequence(), mapping.getdnaSeqs()[0]);
206	1	assertEquals(1, mapping.getdnaSeqs().length);
207	1	assertEquals(1, mapping.getdnaToProt().length);
208	1	assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size());
209	1	assertArrayEquals(new int[] { 400, 423 }, mapping.getdnaToProt()[0]
210		.getFromRanges().get(0));
211	1	assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
212	1	assertArrayEquals(new int[] { 3, 10 }, mapping.getdnaToProt()[0]
213		.getToRanges().get(0));
214		}
215
216		/**
217		* Test processing one exonerate GFF line for the case where the mapping is
218		* protein2dna, similarity feature is on the target (the dna), match to the
219		* reverse strand
220		*
221		* @throws IOException
222		*/
		100% Uncovered Elements: 0 (22) Complexity: 1 Complexity Density: 0.05 1PASS
223	1	@Test(groups = "Functional")...
224		public void testProcessGffSimilarity_protein2dna_reverse_targetgff()
225		throws IOException
226		{
227	1	ExonerateHelper testee = new ExonerateHelper();
228	1	List<SequenceI> newseqs = new ArrayList<SequenceI>();
229	1	String[] gff = "dna1\texonerate:protein2dna:local\tsimilarity\t377\t400\t0\t-\t.\talignment_id 0 ; Query Prot1 ; Align 400 3 24"
230		.split("\\t");
231	1	SequenceI seq = new Sequence("dna1/371-410",
232		"CGATCCGATCCGATCCGATCCGATCCGATCCGATCCGATC");
233	1	seq.createDatasetSequence();
234	1	AlignmentI align = new Alignment(new SequenceI[] { seq });
235		// GFF feature on the target describes mapping from base 400 for
236		// count 24 to position 3
237	1	Map<String, List<String>> set = Gff2Helper.parseNameValuePairs(gff[8]);
238
239		/*
240		* this should create a mapping from virtual sequence dna1 (added to
241		* newseqs) positions 400-377 (reverse) to Prot1/3-10
242		*/
243	1	testee.processGffSimilarity(set, seq, gff, align, newseqs, false);
244	1	assertEquals(1, newseqs.size());
245	1	assertTrue(newseqs.get(0) instanceof SequenceDummy);
246	1	assertEquals("Prot1", newseqs.get(0).getName());
247	1	assertEquals(1, align.getCodonFrames().size());
248	1	AlignedCodonFrame mapping = align.getCodonFrames().iterator().next();
249	1	assertEquals(1, mapping.getAaSeqs().length);
250	1	assertSame(newseqs.get(0), mapping.getAaSeqs()[0]);
251	1	assertSame(seq.getDatasetSequence(), mapping.getdnaSeqs()[0]);
252	1	assertEquals(1, mapping.getdnaSeqs().length);
253	1	assertEquals(1, mapping.getdnaToProt().length);
254	1	assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size());
255	1	assertArrayEquals(new int[] { 400, 377 }, mapping.getdnaToProt()[0]
256		.getFromRanges().get(0));
257	1	assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
258	1	assertArrayEquals(new int[] { 3, 10 }, mapping.getdnaToProt()[0]
259		.getToRanges().get(0));
260		}
261
262		/**
263		* Tests loading exonerate GFF2 output, including 'similarity' alignment
264		* feature, on to sequences
265		*/
		100% Uncovered Elements: 0 (29) Complexity: 1 Complexity Density: 0.03 1PASS
266	1	@Test(groups = { "Functional" })...
267		public void testAddExonerateGffToAlignment()
268		{
269	1	FileLoader loader = new FileLoader(false);
270	1	AlignFrame af = loader.LoadFileWaitTillLoaded(
271		"examples/testdata/exonerateseqs.fa",
272		DataSourceType.FILE);
273
274	1	af.loadJalviewDataFile("examples/testdata/exonerateoutput.gff",
275		DataSourceType.FILE, null, null);
276
277		/*
278		* verify one mapping to a dummy sequence, one to a real one
279		*/
280	1	List<AlignedCodonFrame> mappings = af
281		.getViewport().getAlignment().getDataset().getCodonFrames();
282	1	assertEquals(2, mappings.size());
283	1	Iterator<AlignedCodonFrame> iter = mappings.iterator();
284
285		// first mapping is to dummy sequence
286	1	AlignedCodonFrame mapping = iter.next();
287	1	Mapping[] mapList = mapping.getProtMappings();
288	1	assertEquals(1, mapList.length);
289	1	assertTrue(mapList[0].getTo() instanceof SequenceDummy);
290	1	assertEquals("DDB_G0269124", mapList[0].getTo().getName());
291
292		// 143 in protein should map to codon [11270, 11269, 11268] in dna
293	1	int[] mappedRegion = mapList[0].getMap().locateInFrom(143, 143);
294	1	assertArrayEquals(new int[] { 11270, 11268 }, mappedRegion);
295
296		// second mapping is to a sequence in the alignment
297	1	mapping = iter.next();
298	1	mapList = mapping.getProtMappings();
299	1	assertEquals(1, mapList.length);
300	1	SequenceI proteinSeq = af.getViewport().getAlignment()
301		.findName("DDB_G0280897");
302	1	assertSame(proteinSeq.getDatasetSequence(), mapList[0].getTo());
303	1	assertEquals(1, mapping.getdnaToProt().length);
304
305		// 143 in protein should map to codon [11270, 11269, 11268] in dna
306	1	mappedRegion = mapList[0].getMap().locateInFrom(143, 143);
307	1	assertArrayEquals(new int[] { 11270, 11268 }, mappedRegion);
308
309		// 182 in protein should map to codon [11153, 11152, 11151] in dna
310	1	mappedRegion = mapList[0].getMap().locateInFrom(182, 182);
311	1	assertArrayEquals(new int[] { 11153, 11151 }, mappedRegion);
312
313		// and the reverse mapping:
314	1	mappedRegion = mapList[0].getMap().locateInTo(11151, 11153);
315	1	assertArrayEquals(new int[] { 182, 182 }, mappedRegion);
316
317		// 11150 in dna should _not_ map to protein
318	1	mappedRegion = mapList[0].getMap().locateInTo(11150, 11150);
319	1	assertNull(mappedRegion);
320
321		// similarly 183 in protein should _not_ map to dna
322	1	mappedRegion = mapList[0].getMap().locateInFrom(183, 183);
323	1	assertNull(mappedRegion);
324		}
325		}