Classes

Class	Line #	Total Statements	Complexity	TOTAL Coverage	Actions
GffTests	50	27	2	0.00%	Show methods

Class GffTests

Class GffTests	Line # 50	Total Statements 27	Complexity 2	TOTAL Coverage 0.00%
setUpJvOptionPane() : void   setUpJvOptionPane() : void	5353	2.02	1.01	0.0 0.00%
testResolveExonerateGff() : void   testResolveExonerateGff() : void	6565	25.025	1.01	0.0 0.00%

 

Contributing tests

Source view

1		/*
2		* Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
3		* Copyright (C) $$Year-Rel$$ The Jalview Authors
4		*
5		* This file is part of Jalview.
6		*
7		* Jalview is free software: you can redistribute it and/or
8		* modify it under the terms of the GNU General Public License
9		* as published by the Free Software Foundation, either version 3
10		* of the License, or (at your option) any later version.
11		*
12		* Jalview is distributed in the hope that it will be useful, but
13		* WITHOUT ANY WARRANTY; without even the implied warranty
14		* of MERCHANTABILITY or FITNESS FOR A PARTICULAR
15		* PURPOSE. See the GNU General Public License for more details.
16		*
17		* You should have received a copy of the GNU General Public License
18		* along with Jalview. If not, see <http://www.gnu.org/licenses/>.
19		* The Jalview Authors are detailed in the 'AUTHORS' file.
20		*/
21		package jalview.io.gff;
22
23		import static org.testng.AssertJUnit.assertEquals;
24		import static org.testng.AssertJUnit.assertSame;
25		import static org.testng.AssertJUnit.assertTrue;
26		import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals;
27
28		import jalview.datamodel.AlignedCodonFrame;
29		import jalview.datamodel.Alignment;
30		import jalview.datamodel.AlignmentI;
31		import jalview.datamodel.Mapping;
32		import jalview.datamodel.Sequence;
33		import jalview.datamodel.SequenceDummy;
34		import jalview.datamodel.SequenceI;
35		import jalview.gui.AlignFrame;
36		import jalview.gui.JvOptionPane;
37		import jalview.io.DataSourceType;
38		import jalview.io.FileLoader;
39
40		import java.util.List;
41
42		import org.testng.annotations.BeforeClass;
43		import org.testng.annotations.Test;
44
45		/**
46		* Tests of use cases that include parsing GFF (version 2 or 3) features that
47		* describe mappings between protein and cDNA. The format of the GFF varies
48		* depending on which tool generated it.
49		*/
		0% Uncovered Elements: 29 (29) Complexity: 2 Complexity Density: 0.07
50		public class GffTests
51		{
52
		0% Uncovered Elements: 2 (2) Complexity: 1 Complexity Density: 0.5
53	0	@BeforeClass(alwaysRun = true)...
54		public void setUpJvOptionPane()
55		{
56	0	JvOptionPane.setInteractiveMode(false);
57	0	JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION);
58		}
59
60		/**
61		* Test the case where we load a protein ('query') sequence, then exonerateGff
62		* describing its mapping to cDNA, and then a DNA sequence including the
63		* mapped region
64		*/
		0% Uncovered Elements: 25 (25) Complexity: 1 Complexity Density: 0.04 4-
65	0	@Test(groups = "Functional")...
66		public void testResolveExonerateGff()
67		{
68	0	String proteinSeq = ">prot1/10-16\nYCWRSGA";
69	0	AlignFrame af = new FileLoader(false).LoadFileWaitTillLoaded(proteinSeq,
70		DataSourceType.PASTE);
71
72		/*
73		* exonerate GFF output mapping residues 11-15 (CWRSG)
74		* to bases 24-10 in sequence 'dna1' (reverse strand)
75		*/
76	0	String exonerateGff = "##gff-version 2\n"
77		+ "prot1\tprotein2genome\tsimilarity\t11\t15\t99\t-\t.\talignment_id 0 ; Target dna1 ; Align 11 24 5";
78	0	af.loadJalviewDataFile(exonerateGff, DataSourceType.PASTE, null, null);
79
80		/*
81		* check we have a mapping from prot1 to SequenceDummy 'dna1'
82		*/
83	0	AlignmentI dataset = af.getViewport().getAlignment().getDataset();
84	0	assertEquals(1, dataset.getSequences().size());
85	0	assertEquals("prot1", dataset.getSequenceAt(0).getName());
86	0	assertEquals("YCWRSGA", dataset.getSequenceAt(0).getSequenceAsString());
87	0	List<AlignedCodonFrame> mappings = dataset.getCodonFrames();
88	0	assertEquals(1, mappings.size());
89	0	AlignedCodonFrame mapping = mappings.iterator().next();
90	0	SequenceI mappedDna = mapping.getDnaForAaSeq(dataset.getSequenceAt(0));
91	0	assertTrue(mappedDna instanceof SequenceDummy);
92	0	assertEquals("dna1", mappedDna.getName());
93	0	Mapping[] mapList = mapping.getProtMappings();
94	0	assertEquals(1, mapList.length);
95		// 11 in protein should map to codon [24, 23, 22] in dna
96	0	int[] mappedRegion = mapList[0].getMap().locateInFrom(11, 11);
97	0	assertArrayEquals(new int[] { 24, 22 }, mappedRegion);
98		// 15 in protein should map to codon [12, 11, 10] in dna
99	0	mappedRegion = mapList[0].getMap().locateInFrom(15, 15);
100	0	assertArrayEquals(new int[] { 12, 10 }, mappedRegion);
101
102	0	SequenceI dna1 = new Sequence("dna1", "AAACCCGGGTTTAAACCCGGGTTT");
103	0	AlignmentI al = new Alignment(new SequenceI[] { dna1 });
104	0	al.setDataset(null);
105
106		/*
107		* Now 'realise' the virtual mapping to the real DNA sequence;
108		* interactively this could be by a drag or fetch of the sequence data
109		* on to the alignment
110		*/
111	0	mapping.realiseWith(dna1);
112		// verify the mapping is now from the real, not the dummy sequence
113	0	assertSame(dna1.getDatasetSequence(),
114		mapping.getDnaForAaSeq(dataset.getSequenceAt(0)));
115		}
116		}