Classes

Class	Line #	Total Statements	Complexity	Uncovered Elements	TOTAL Coverage	Actions
EmblTestHelper	25	1	1	0	1.0100%	Show methods

Class EmblTestHelper

Class EmblTestHelper	Line # 25	Total Statements 1	Complexity 1	Uncovered Elements 0	TOTAL Coverage 1.0100%
getEmblFile() : EmblFile   getEmblFile() : EmblFile	7777	1.01	1.01	0.00	1.0 1.0100%

 

Contributing tests

Contributing tests

Select all

	Test contribution	Test	Result	Actions
	1.0	jalview.datamodel.xdb.embl.EmblEntryTest.testParseCodingFeaturejalview.datamodel.xdb.embl.EmblEntryTest.testParseCodingFeature	1PASS
	1.0	jalview.datamodel.xdb.embl.EmblFileTest.testGetEmblFilejalview.datamodel.xdb.embl.EmblFileTest.testGetEmblFile	1PASS

 

Source view

1		/*
2		* Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
3		* Copyright (C) $$Year-Rel$$ The Jalview Authors
4		*
5		* This file is part of Jalview.
6		*
7		* Jalview is free software: you can redistribute it and/or
8		* modify it under the terms of the GNU General Public License
9		* as published by the Free Software Foundation, either version 3
10		* of the License, or (at your option) any later version.
11		*
12		* Jalview is distributed in the hope that it will be useful, but
13		* WITHOUT ANY WARRANTY; without even the implied warranty
14		* of MERCHANTABILITY or FITNESS FOR A PARTICULAR
15		* PURPOSE. See the GNU General Public License for more details.
16		*
17		* You should have received a copy of the GNU General Public License
18		* along with Jalview. If not, see <http://www.gnu.org/licenses/>.
19		* The Jalview Authors are detailed in the 'AUTHORS' file.
20		*/
21		package jalview.datamodel.xdb.embl;
22
23		import java.io.StringReader;
24
		100% Uncovered Elements: 0 (2) Complexity: 1 Complexity Density: 1
25		public class EmblTestHelper
26		{
27		// adapted from http://www.ebi.ac.uk/ena/data/view/X07547&display=xml
28		// dna and translations truncated for convenience
29		private static final String TESTDATA = "<?xml version=\"1.0\" encoding=\"UTF-8\" ?>"
30		+ "<ROOT>"
31		+ "<entry accession=\"X07547\" version=\"1\" entryVersion=\"8\""
32		+ " dataClass=\"STD\" taxonomicDivision=\"PRO\""
33		+ " moleculeType=\"genomic DNA\" sequenceLength=\"7499\" topology=\"linear\""
34		+ " firstPublic=\"1988-11-10\" firstPublicRelease=\"18\""
35		+ " lastUpdated=\"1999-02-10\" lastUpdatedRelease=\"58\">"
36		+ "<secondaryAccession>X07574</secondaryAccession>"
37		+ "<description>C. trachomatis plasmid</description>"
38		+ "<keyword>plasmid</keyword><keyword>unidentified reading frame</keyword>"
39		+ "<xref db=\"EuropePMC\" id=\"PMC107176\" secondaryId=\"9573186\" />"
40		+ "<xref db=\"MD5\" id=\"ac73317\" />"
41		/*
42		* first CDS (range and translation changed to keep test data manageable)
43		*/
44		+ "<feature name=\"CDS\" location=\"complement(46..57)\">"
45		// test the case of >1 cross-ref to the same database (JAL-2029)
46		+ "<xref db=\"UniProtKB/Swiss-Prot\" id=\"B0BCM4\" secondaryId=\"2.1\" />"
47		+ "<xref db=\"UniProtKB/Swiss-Prot\" id=\"P0CE20\" />"
48		+ "<qualifier name=\"note\"><value>ORF 8 (AA 1-330)</value><value>pickle</value></qualifier>"
49		+ "<qualifier name=\"protein_id\"><value>CAA30420.1</value></qualifier>"
50		+ "<qualifier name=\"translation\"><value>MLCF</value><evidence>Keith</evidence></qualifier>"
51		+ "</feature>"
52		/*
53		* second CDS (range and translation changed to keep test data manageable)
54		*/
55		+ "<feature name=\"CDS\" location=\"4..15\">"
56		+ "<xref db=\"UniProtKB/Swiss-Prot\" id=\"B0BCM3\" />"
57		+ "<qualifier name=\"protein_id\"><value>CAA30421.1</value></qualifier>"
58		+ "<qualifier name=\"translation\"><value>MSSS</value></qualifier>"
59		+ "</feature>"
60		/*
61		* third CDS is made up - has no xref - code should synthesize
62		* one to an assumed EMBLCDSPROTEIN accession
63		*/
64		+ "<feature name=\"CDS\" location=\"join(4..6,10..15)\">"
65		+ "<qualifier name=\"protein_id\"><value>CAA12345.6</value></qualifier>"
66		+ "<qualifier name=\"translation\"><value>MSS</value></qualifier>"
67		+ "</feature>"
68		/*
69		* sequence (modified for test purposes)
70		* emulates EMBL XML 1.2 which splits sequence data every 60 characters
71		* see EmblSequence.setSequence
72		*/
73		+ "<sequence>GGTATGTCCTCTAGTACAAAC\n"
74		+ "ACCCCCAATATTGTGATATAATTAAAAACATAGCAT"
75		+ "</sequence></entry></ROOT>";
76
		100% Uncovered Elements: 0 (1) Complexity: 1 Complexity Density: 1
77	2	static EmblFile getEmblFile()...
78		{
79	2	return EmblFile.getEmblFile(new StringReader(TESTDATA));
80		}
81		}