Clover icon

Coverage Report

  1. Project Clover database Wed Jan 14 2026 14:33:33 GMT
  2. Package jalview.io.gff

File ExonerateHelperTest.java

 

Code metrics

0
126
7
1
323
210
7
0.06
18
7
1

Classes

Class Line # Actions
ExonerateHelperTest 51 126 7
1.0100%
 

Contributing tests

This file is covered by 6 tests. .

Source view

1    /*
2    * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
3    * Copyright (C) $$Year-Rel$$ The Jalview Authors
4    *
5    * This file is part of Jalview.
6    *
7    * Jalview is free software: you can redistribute it and/or
8    * modify it under the terms of the GNU General Public License
9    * as published by the Free Software Foundation, either version 3
10    * of the License, or (at your option) any later version.
11    *
12    * Jalview is distributed in the hope that it will be useful, but
13    * WITHOUT ANY WARRANTY; without even the implied warranty
14    * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
15    * PURPOSE. See the GNU General Public License for more details.
16    *
17    * You should have received a copy of the GNU General Public License
18    * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
19    * The Jalview Authors are detailed in the 'AUTHORS' file.
20    */
21    package jalview.io.gff;
22   
23    import static org.testng.AssertJUnit.assertEquals;
24    import static org.testng.AssertJUnit.assertNull;
25    import static org.testng.AssertJUnit.assertSame;
26    import static org.testng.AssertJUnit.assertTrue;
27    import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals;
28   
29    import jalview.datamodel.AlignedCodonFrame;
30    import jalview.datamodel.Alignment;
31    import jalview.datamodel.AlignmentI;
32    import jalview.datamodel.Mapping;
33    import jalview.datamodel.MappingType;
34    import jalview.datamodel.Sequence;
35    import jalview.datamodel.SequenceDummy;
36    import jalview.datamodel.SequenceI;
37    import jalview.gui.AlignFrame;
38    import jalview.gui.JvOptionPane;
39    import jalview.io.DataSourceType;
40    import jalview.io.FileLoader;
41   
42    import java.io.IOException;
43    import java.util.ArrayList;
44    import java.util.Iterator;
45    import java.util.List;
46    import java.util.Map;
47   
48    import org.testng.annotations.BeforeClass;
49    import org.testng.annotations.Test;
50   
 
51    public class ExonerateHelperTest
52    {
53   
 
54  1 toggle @BeforeClass(alwaysRun = true)
55    public void setUpJvOptionPane()
56    {
57  1 JvOptionPane.setInteractiveMode(false);
58  1 JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION);
59    }
60   
 
61  1 toggle @Test(groups = "Functional")
62    public void testGetMappingType()
63    {
64    // protein-to-dna:
65  1 assertSame(MappingType.PeptideToNucleotide, ExonerateHelper
66    .getMappingType("exonerate:protein2genome:local"));
67  1 assertSame(MappingType.PeptideToNucleotide,
68    ExonerateHelper.getMappingType("exonerate:protein2dna:local"));
69   
70    // dna-to-dna:
71  1 assertSame(MappingType.NucleotideToNucleotide,
72    ExonerateHelper.getMappingType("coding2coding"));
73  1 assertSame(MappingType.NucleotideToNucleotide,
74    ExonerateHelper.getMappingType("coding2genome"));
75  1 assertSame(MappingType.NucleotideToNucleotide,
76    ExonerateHelper.getMappingType("cdna2genome"));
77  1 assertSame(MappingType.NucleotideToNucleotide,
78    ExonerateHelper.getMappingType("genome2genome"));
79  1 assertNull(ExonerateHelper.getMappingType("affine:local"));
80    }
81   
82    /**
83    * Test processing one exonerate GFF line for the case where the mapping is
84    * protein2dna, similarity feature is on the query (the protein), match to the
85    * forward strand, target sequence is in neither the alignment nor the 'new
86    * sequences'
87    *
88    * @throws IOException
89    */
 
90  1 toggle @Test(groups = "Functional")
91    public void testProcessGffSimilarity_protein2dna_forward_querygff()
92    throws IOException
93    {
94  1 ExonerateHelper testee = new ExonerateHelper();
95  1 List<SequenceI> newseqs = new ArrayList<SequenceI>();
96  1 String[] gff = "Seq\texonerate:protein2dna:local\tsimilarity\t3\t10\t.\t+\t.\talignment_id 0 ; Target dna1 ; Align 3 400 8"
97    .split("\\t");
98  1 SequenceI seq = new Sequence("Seq", "PQRASTGKEEDVMIWCHQN");
99  1 seq.createDatasetSequence();
100  1 AlignmentI align = new Alignment(new SequenceI[] {});
101  1 Map<String, List<String>> set = Gff2Helper.parseNameValuePairs(gff[8]);
102   
103    /*
104    * this should create a mapping from Seq2/3-10 to virtual sequence
105    * dna1 (added to newseqs) positions 400-423
106    */
107  1 testee.processGffSimilarity(set, seq, gff, align, newseqs, false);
108  1 assertEquals(1, newseqs.size());
109  1 assertTrue(newseqs.get(0) instanceof SequenceDummy);
110  1 assertEquals("dna1", newseqs.get(0).getName());
111  1 assertEquals(1, align.getCodonFrames().size());
112  1 AlignedCodonFrame mapping = align.getCodonFrames().iterator().next();
113  1 assertEquals(1, mapping.getAaSeqs().length);
114  1 assertSame(seq.getDatasetSequence(), mapping.getAaSeqs()[0]);
115  1 assertEquals(1, mapping.getdnaSeqs().length);
116  1 assertSame(newseqs.get(0), mapping.getdnaSeqs()[0]);
117  1 assertEquals(1, mapping.getdnaToProt().length);
118  1 assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size());
119  1 assertArrayEquals(new int[] { 400, 423 },
120    mapping.getdnaToProt()[0].getFromRanges().get(0));
121  1 assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
122  1 assertArrayEquals(new int[] { 3, 10 },
123    mapping.getdnaToProt()[0].getToRanges().get(0));
124    }
125   
126    /**
127    * Test processing one exonerate GFF line for the case where the mapping is
128    * protein2dna, similarity feature is on the query (the protein), match to the
129    * reverse strand
130    *
131    * @throws IOException
132    */
 
133  1 toggle @Test(groups = "Functional")
134    public void testProcessGffSimilarity_protein2dna_reverse_querygff()
135    throws IOException
136    {
137  1 ExonerateHelper testee = new ExonerateHelper();
138  1 List<SequenceI> newseqs = new ArrayList<SequenceI>();
139  1 String[] gff = "Seq\texonerate:protein2dna:local\tsimilarity\t3\t10\t0\t-\t.\talignment_id 0 ; Target dna1 ; Align 3 400 8"
140    .split("\\t");
141  1 SequenceI seq = new Sequence("Seq", "PQRASTGKEEDVMIWCHQN");
142  1 seq.createDatasetSequence();
143  1 AlignmentI align = new Alignment(new SequenceI[] {});
144  1 Map<String, List<String>> set = Gff2Helper.parseNameValuePairs(gff[8]);
145   
146    /*
147    * this should create a mapping from Seq2/3-10 to virtual sequence
148    * dna1 (added to newseqs) positions 400-377 (reverse)
149    */
150  1 testee.processGffSimilarity(set, seq, gff, align, newseqs, false);
151  1 assertEquals(1, newseqs.size());
152  1 assertTrue(newseqs.get(0) instanceof SequenceDummy);
153  1 assertEquals("dna1", newseqs.get(0).getName());
154  1 assertEquals(1, align.getCodonFrames().size());
155  1 AlignedCodonFrame mapping = align.getCodonFrames().iterator().next();
156  1 assertEquals(1, mapping.getAaSeqs().length);
157  1 assertSame(seq.getDatasetSequence(), mapping.getAaSeqs()[0]);
158  1 assertEquals(1, mapping.getdnaSeqs().length);
159  1 assertSame(newseqs.get(0), mapping.getdnaSeqs()[0]);
160  1 assertEquals(1, mapping.getdnaToProt().length);
161  1 assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size());
162  1 assertArrayEquals(new int[] { 400, 377 },
163    mapping.getdnaToProt()[0].getFromRanges().get(0));
164  1 assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
165  1 assertArrayEquals(new int[] { 3, 10 },
166    mapping.getdnaToProt()[0].getToRanges().get(0));
167    }
168   
169    /**
170    * Test processing one exonerate GFF line for the case where the mapping is
171    * protein2dna, similarity feature is on the target (the dna), match to the
172    * forward strand
173    *
174    * @throws IOException
175    */
 
176  1 toggle @Test(groups = "Functional")
177    public void testProcessGffSimilarity_protein2dna_forward_targetgff()
178    throws IOException
179    {
180  1 ExonerateHelper testee = new ExonerateHelper();
181  1 List<SequenceI> newseqs = new ArrayList<SequenceI>();
182  1 String[] gff = "dna1\texonerate:protein2dna:local\tsimilarity\t400\t423\t0\t+\t.\talignment_id 0 ; Query Prot1 ; Align 400 3 24"
183    .split("\\t");
184  1 SequenceI seq = new Sequence("dna1/391-430",
185    "CGATCCGATCCGATCCGATCCGATCCGATCCGATCCGATC");
186  1 seq.createDatasetSequence();
187  1 AlignmentI align = new Alignment(new SequenceI[] { seq });
188    // GFF feature on the target describes mapping from base 400 for
189    // count 24 to position 3
190  1 Map<String, List<String>> set = Gff2Helper.parseNameValuePairs(gff[8]);
191   
192    /*
193    * this should create a mapping from virtual sequence dna1 (added to
194    * newseqs) positions 400-423 to Prot1/3-10
195    */
196  1 testee.processGffSimilarity(set, seq, gff, align, newseqs, false);
197  1 assertEquals(1, newseqs.size());
198  1 assertTrue(newseqs.get(0) instanceof SequenceDummy);
199  1 assertEquals("Prot1", newseqs.get(0).getName());
200  1 assertEquals(1, align.getCodonFrames().size());
201  1 AlignedCodonFrame mapping = align.getCodonFrames().iterator().next();
202  1 assertEquals(1, mapping.getAaSeqs().length);
203  1 assertSame(newseqs.get(0), mapping.getAaSeqs()[0]);
204  1 assertSame(seq.getDatasetSequence(), mapping.getdnaSeqs()[0]);
205  1 assertEquals(1, mapping.getdnaSeqs().length);
206  1 assertEquals(1, mapping.getdnaToProt().length);
207  1 assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size());
208  1 assertArrayEquals(new int[] { 400, 423 },
209    mapping.getdnaToProt()[0].getFromRanges().get(0));
210  1 assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
211  1 assertArrayEquals(new int[] { 3, 10 },
212    mapping.getdnaToProt()[0].getToRanges().get(0));
213    }
214   
215    /**
216    * Test processing one exonerate GFF line for the case where the mapping is
217    * protein2dna, similarity feature is on the target (the dna), match to the
218    * reverse strand
219    *
220    * @throws IOException
221    */
 
222  1 toggle @Test(groups = "Functional")
223    public void testProcessGffSimilarity_protein2dna_reverse_targetgff()
224    throws IOException
225    {
226  1 ExonerateHelper testee = new ExonerateHelper();
227  1 List<SequenceI> newseqs = new ArrayList<SequenceI>();
228  1 String[] gff = "dna1\texonerate:protein2dna:local\tsimilarity\t377\t400\t0\t-\t.\talignment_id 0 ; Query Prot1 ; Align 400 3 24"
229    .split("\\t");
230  1 SequenceI seq = new Sequence("dna1/371-410",
231    "CGATCCGATCCGATCCGATCCGATCCGATCCGATCCGATC");
232  1 seq.createDatasetSequence();
233  1 AlignmentI align = new Alignment(new SequenceI[] { seq });
234    // GFF feature on the target describes mapping from base 400 for
235    // count 24 to position 3
236  1 Map<String, List<String>> set = Gff2Helper.parseNameValuePairs(gff[8]);
237   
238    /*
239    * this should create a mapping from virtual sequence dna1 (added to
240    * newseqs) positions 400-377 (reverse) to Prot1/3-10
241    */
242  1 testee.processGffSimilarity(set, seq, gff, align, newseqs, false);
243  1 assertEquals(1, newseqs.size());
244  1 assertTrue(newseqs.get(0) instanceof SequenceDummy);
245  1 assertEquals("Prot1", newseqs.get(0).getName());
246  1 assertEquals(1, align.getCodonFrames().size());
247  1 AlignedCodonFrame mapping = align.getCodonFrames().iterator().next();
248  1 assertEquals(1, mapping.getAaSeqs().length);
249  1 assertSame(newseqs.get(0), mapping.getAaSeqs()[0]);
250  1 assertSame(seq.getDatasetSequence(), mapping.getdnaSeqs()[0]);
251  1 assertEquals(1, mapping.getdnaSeqs().length);
252  1 assertEquals(1, mapping.getdnaToProt().length);
253  1 assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size());
254  1 assertArrayEquals(new int[] { 400, 377 },
255    mapping.getdnaToProt()[0].getFromRanges().get(0));
256  1 assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
257  1 assertArrayEquals(new int[] { 3, 10 },
258    mapping.getdnaToProt()[0].getToRanges().get(0));
259    }
260   
261    /**
262    * Tests loading exonerate GFF2 output, including 'similarity' alignment
263    * feature, on to sequences
264    */
 
265  1 toggle @Test(groups = { "Functional" })
266    public void testAddExonerateGffToAlignment()
267    {
268  1 FileLoader loader = new FileLoader(false);
269  1 AlignFrame af = loader.LoadFileWaitTillLoaded(
270    "examples/testdata/exonerateseqs.fa", DataSourceType.FILE);
271   
272  1 af.loadJalviewDataFile("examples/testdata/exonerateoutput.gff",
273    DataSourceType.FILE, null, null);
274   
275    /*
276    * verify one mapping to a dummy sequence, one to a real one
277    */
278  1 List<AlignedCodonFrame> mappings = af.getViewport().getAlignment()
279    .getDataset().getCodonFrames();
280  1 assertEquals(2, mappings.size());
281  1 Iterator<AlignedCodonFrame> iter = mappings.iterator();
282   
283    // first mapping is to dummy sequence
284  1 AlignedCodonFrame mapping = iter.next();
285  1 Mapping[] mapList = mapping.getProtMappings();
286  1 assertEquals(1, mapList.length);
287  1 assertTrue(mapList[0].getTo() instanceof SequenceDummy);
288  1 assertEquals("DDB_G0269124", mapList[0].getTo().getName());
289   
290    // 143 in protein should map to codon [11270, 11269, 11268] in dna
291  1 int[] mappedRegion = mapList[0].getMap().locateInFrom(143, 143);
292  1 assertArrayEquals(new int[] { 11270, 11268 }, mappedRegion);
293   
294    // second mapping is to a sequence in the alignment
295  1 mapping = iter.next();
296  1 mapList = mapping.getProtMappings();
297  1 assertEquals(1, mapList.length);
298  1 SequenceI proteinSeq = af.getViewport().getAlignment()
299    .findName("DDB_G0280897");
300  1 assertSame(proteinSeq.getDatasetSequence(), mapList[0].getTo());
301  1 assertEquals(1, mapping.getdnaToProt().length);
302   
303    // 143 in protein should map to codon [11270, 11269, 11268] in dna
304  1 mappedRegion = mapList[0].getMap().locateInFrom(143, 143);
305  1 assertArrayEquals(new int[] { 11270, 11268 }, mappedRegion);
306   
307    // 182 in protein should map to codon [11153, 11152, 11151] in dna
308  1 mappedRegion = mapList[0].getMap().locateInFrom(182, 182);
309  1 assertArrayEquals(new int[] { 11153, 11151 }, mappedRegion);
310   
311    // and the reverse mapping:
312  1 mappedRegion = mapList[0].getMap().locateInTo(11151, 11153);
313  1 assertArrayEquals(new int[] { 182, 182 }, mappedRegion);
314   
315    // 11150 in dna should _not_ map to protein
316  1 mappedRegion = mapList[0].getMap().locateInTo(11150, 11150);
317  1 assertNull(mappedRegion);
318   
319    // similarly 183 in protein should _not_ map to dna
320  1 mappedRegion = mapList[0].getMap().locateInFrom(183, 183);
321  1 assertNull(mappedRegion);
322    }
323    }