Classes

Class	Line #	Total Statements	Complexity	TOTAL Coverage	Actions
Gff3HelperTest	47	103	6	1.0100%	Show methods

Class Gff3HelperTest

Class Gff3HelperTest	Line # 47	Total Statements 103	Complexity 6	TOTAL Coverage 1.0100%
setUpJvOptionPane() : void   setUpJvOptionPane() : void	5050	2.02	1.01	1.0 1.0100%
testProcessCdnaMatch_forwardToForward() : void   testProcessCdnaMatch_forwardToForward() : void	6363	21.021	1.01	1.0 1.0100%
testProcessCdnaMatch_forwardToReverse() : void   testProcessCdnaMatch_forwardToReverse() : void	110110	21.021	1.01	1.0 1.0100%
testProcessCdnaMatch_reverseToForward() : void   testProcessCdnaMatch_reverseToForward() : void	157157	9.09	1.01	1.0 1.0100%
testProcessCdnaMatch_spliced() : void   testProcessCdnaMatch_spliced() : void	186186	24.024	1.01	1.0 1.0100%
testGetDescription() : void   testGetDescription() : void	236236	26.026	1.01	1.0 1.0100%

 

Contributing tests

Contributing tests

Select all

	Test contribution	Test	Result	Actions
	0.24770643	jalview.io.gff.Gff3HelperTest.testGetDescriptionjalview.io.gff.Gff3HelperTest.testGetDescription	1PASS
	0.2293578	jalview.io.gff.Gff3HelperTest.testProcessCdnaMatch_splicedjalview.io.gff.Gff3HelperTest.testProcessCdnaMatch_spliced	1PASS
	0.20183486	jalview.io.gff.Gff3HelperTest.testProcessCdnaMatch_forwardToReversejalview.io.gff.Gff3HelperTest.testProcessCdnaMatch_forwardToReverse	1PASS
	0.20183486	jalview.io.gff.Gff3HelperTest.testProcessCdnaMatch_forwardToForwardjalview.io.gff.Gff3HelperTest.testProcessCdnaMatch_forwardToForward	1PASS
	0.09174312	jalview.io.gff.Gff3HelperTest.testProcessCdnaMatch_reverseToForwardjalview.io.gff.Gff3HelperTest.testProcessCdnaMatch_reverseToForward	1PASS

 

Source view

1		/*
2		* Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
3		* Copyright (C) $$Year-Rel$$ The Jalview Authors
4		*
5		* This file is part of Jalview.
6		*
7		* Jalview is free software: you can redistribute it and/or
8		* modify it under the terms of the GNU General Public License
9		* as published by the Free Software Foundation, either version 3
10		* of the License, or (at your option) any later version.
11		*
12		* Jalview is distributed in the hope that it will be useful, but
13		* WITHOUT ANY WARRANTY; without even the implied warranty
14		* of MERCHANTABILITY or FITNESS FOR A PARTICULAR
15		* PURPOSE. See the GNU General Public License for more details.
16		*
17		* You should have received a copy of the GNU General Public License
18		* along with Jalview. If not, see <http://www.gnu.org/licenses/>.
19		* The Jalview Authors are detailed in the 'AUTHORS' file.
20		*/
21		package jalview.io.gff;
22
23		import static org.testng.AssertJUnit.assertEquals;
24		import static org.testng.AssertJUnit.assertNull;
25		import static org.testng.AssertJUnit.assertSame;
26		import static org.testng.AssertJUnit.assertTrue;
27		import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals;
28
29		import jalview.datamodel.AlignedCodonFrame;
30		import jalview.datamodel.Alignment;
31		import jalview.datamodel.AlignmentI;
32		import jalview.datamodel.Sequence;
33		import jalview.datamodel.SequenceDummy;
34		import jalview.datamodel.SequenceFeature;
35		import jalview.datamodel.SequenceI;
36		import jalview.gui.JvOptionPane;
37
38		import java.io.IOException;
39		import java.util.ArrayList;
40		import java.util.HashMap;
41		import java.util.List;
42		import java.util.Map;
43
44		import org.testng.annotations.BeforeClass;
45		import org.testng.annotations.Test;
46
		100% Uncovered Elements: 0 (109) Complexity: 6 Complexity Density: 0.06
47		public class Gff3HelperTest
48		{
49
		100% Uncovered Elements: 0 (2) Complexity: 1 Complexity Density: 0.5
50	1	@BeforeClass(alwaysRun = true)...
51		public void setUpJvOptionPane()
52		{
53	1	JvOptionPane.setInteractiveMode(false);
54	1	JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION);
55		}
56
57		/**
58		* Test processing one PASA GFF line giving a match from forward strand to
59		* forward strand
60		*
61		* @throws IOException
62		*/
		100% Uncovered Elements: 0 (21) Complexity: 1 Complexity Density: 0.05 1PASS
63	1	@Test(groups = "Functional")...
64		public void testProcessCdnaMatch_forwardToForward() throws IOException
65		{
66	1	GffHelperBase testee = new Gff3Helper();
67	1	List<SequenceI> newseqs = new ArrayList<SequenceI>();
68	1	String[] gff = "gi|68711\tblat-pasa\tcDNA_match\t12923\t13060\t98.55\t+\t.\tID=align_68;Target=gi|N37351 1 138 +"
69		.split("\\t");
70	1	SequenceI seq = new Sequence("gi|68711",
71		"GAATTCGTTCATGTAGGTTGATTTTTATT");
72	1	seq.createDatasetSequence();
73	1	AlignmentI align = new Alignment(new SequenceI[] {});
74
75		/*
76		* this should create a mapping from gi|68711/12923-13060
77		* to virtual sequence gi|N37351 (added to newseqs) positions 1-138
78		*/
79	1	testee.processGff(seq, gff, align, newseqs, false);
80	1	assertEquals(1, newseqs.size());
81	1	assertTrue(newseqs.get(0) instanceof SequenceDummy);
82	1	assertEquals("gi|N37351", newseqs.get(0).getName());
83	1	assertEquals(1, align.getCodonFrames().size());
84	1	AlignedCodonFrame mapping = align.getCodonFrames().iterator().next();
85
86		/*
87		* 'dnaseqs' (map from) is here [gi|68711]
88		* 'aaseqs' (map to) is here [gi|N37351]
89		*/
90		// TODO use more suitable naming in AlignedCodonFrame
91	1	assertEquals(1, mapping.getAaSeqs().length);
92	1	assertSame(seq.getDatasetSequence(), mapping.getdnaSeqs()[0]);
93	1	assertEquals(1, mapping.getdnaSeqs().length);
94	1	assertSame(newseqs.get(0), mapping.getAaSeqs()[0]);
95	1	assertEquals(1, mapping.getdnaToProt().length);
96	1	assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size());
97	1	assertArrayEquals(new int[] { 12923, 13060 },
98		mapping.getdnaToProt()[0].getFromRanges().get(0));
99	1	assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
100	1	assertArrayEquals(new int[] { 1, 138 },
101		mapping.getdnaToProt()[0].getToRanges().get(0));
102		}
103
104		/**
105		* Test processing one PASA GFF line giving a match from forward strand to
106		* reverse strand
107		*
108		* @throws IOException
109		*/
		100% Uncovered Elements: 0 (21) Complexity: 1 Complexity Density: 0.05 1PASS
110	1	@Test(groups = "Functional")...
111		public void testProcessCdnaMatch_forwardToReverse() throws IOException
112		{
113	1	GffHelperBase testee = new Gff3Helper();
114	1	List<SequenceI> newseqs = new ArrayList<SequenceI>();
115	1	String[] gff = "gi|68711\tblat-pasa\tcDNA_match\t12923\t13060\t98.55\t+\t.\tID=align_68;Target=gi|N37351 1 138 -"
116		.split("\\t");
117	1	SequenceI seq = new Sequence("gi|68711",
118		"GAATTCGTTCATGTAGGTTGATTTTTATT");
119	1	seq.createDatasetSequence();
120	1	AlignmentI align = new Alignment(new SequenceI[] {});
121
122		/*
123		* this should create a mapping from gi|68711/12923-13060
124		* to virtual sequence gi|N37351 (added to newseqs) positions 138-1
125		*/
126	1	testee.processGff(seq, gff, align, newseqs, false);
127	1	assertEquals(1, newseqs.size());
128	1	assertTrue(newseqs.get(0) instanceof SequenceDummy);
129	1	assertEquals("gi|N37351", newseqs.get(0).getName());
130	1	assertEquals(1, align.getCodonFrames().size());
131	1	AlignedCodonFrame mapping = align.getCodonFrames().iterator().next();
132
133		/*
134		* 'dnaseqs' (map from) is here [gi|68711]
135		* 'aaseqs' (map to) is here [gi|N37351]
136		*/
137		// TODO use more suitable naming in AlignedCodonFrame
138	1	assertEquals(1, mapping.getAaSeqs().length);
139	1	assertSame(seq.getDatasetSequence(), mapping.getdnaSeqs()[0]);
140	1	assertEquals(1, mapping.getdnaSeqs().length);
141	1	assertSame(newseqs.get(0), mapping.getAaSeqs()[0]);
142	1	assertEquals(1, mapping.getdnaToProt().length);
143	1	assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size());
144	1	assertArrayEquals(new int[] { 12923, 13060 },
145		mapping.getdnaToProt()[0].getFromRanges().get(0));
146	1	assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
147	1	assertArrayEquals(new int[] { 138, 1 },
148		mapping.getdnaToProt()[0].getToRanges().get(0));
149		}
150
151		/**
152		* Test processing one PASA GFF line giving a match from reverse complement
153		* strand to forward strand
154		*
155		* @throws IOException
156		*/
		100% Uncovered Elements: 0 (9) Complexity: 1 Complexity Density: 0.11 1PASS
157	1	@Test(groups = "Functional")...
158		public void testProcessCdnaMatch_reverseToForward() throws IOException
159		{
160	1	GffHelperBase testee = new Gff3Helper();
161	1	List<SequenceI> newseqs = new ArrayList<SequenceI>();
162	1	String[] gff = "gi|68711\tblat-pasa\tcDNA_match\t12923\t13060\t98.55\t-\t.\tID=align_68;Target=gi|N37351 1 138 +"
163		.split("\\t");
164	1	SequenceI seq = new Sequence("gi|68711",
165		"GAATTCGTTCATGTAGGTTGATTTTTATT");
166	1	seq.createDatasetSequence();
167	1	AlignmentI align = new Alignment(new SequenceI[] {});
168
169		/*
170		* (For now) we don't process reverse complement mappings; to do this
171		* would require (a) creating a virtual sequence placeholder for the
172		* reverse complement (b) resolving the sequence by its id from some
173		* source (GFF ##FASTA or other) (c) creating the reverse complement
174		* sequence (d) updating the mapping to be to the reverse complement
175		*/
176	1	SequenceFeature sf = testee.processGff(seq, gff, align, newseqs, false);
177	1	assertNull(sf);
178	1	assertTrue(newseqs.isEmpty());
179		}
180
181		/**
182		* Test processing two PASA GFF lines representing a spliced mapping
183		*
184		* @throws IOException
185		*/
		100% Uncovered Elements: 0 (24) Complexity: 1 Complexity Density: 0.04 1PASS
186	1	@Test(groups = "Functional")...
187		public void testProcessCdnaMatch_spliced() throws IOException
188		{
189	1	GffHelperBase testee = new Gff3Helper();
190	1	List<SequenceI> newseqs = new ArrayList<SequenceI>();
191	1	SequenceI seq = new Sequence("gi|68711",
192		"GAATTCGTTCATGTAGGTTGATTTTTATT");
193	1	seq.createDatasetSequence();
194	1	AlignmentI align = new Alignment(new SequenceI[] {});
195
196		// mapping from gi|68711 12923-13060 to gi|N37351 1-138
197	1	String[] gff = "gi|68711\tblat-pasa\tcDNA_match\t12923\t13060\t98.55\t+\t.\tID=align_68;Target=gi|N37351 1 138 +"
198		.split("\\t");
199	1	testee.processGff(seq, gff, align, newseqs, false);
200		// mapping from gi|68711 13411-13550 to gi|N37351 139-278
201	1	gff = "gi|68711\tblat-pasa\tcDNA_match\t13411\t13550\t98.55\t+\t.\tID=align_68;Target=gi|N37351 139 278 +"
202		.split("\\t");
203	1	testee.processGff(seq, gff, align, newseqs, false);
204
205	1	assertEquals(1, newseqs.size());
206	1	assertTrue(newseqs.get(0) instanceof SequenceDummy);
207	1	assertEquals("gi|N37351", newseqs.get(0).getName());
208
209		// only 1 AlignedCodonFrame added to the alignment with both mappings!
210		// (this is important for 'align cdna to genome' to work correctly)
211	1	assertEquals(1, align.getCodonFrames().size());
212	1	AlignedCodonFrame mapping = align.getCodonFrames().get(0);
213
214		/*
215		* 'dnaseqs' (map from) is here [gi|68711]
216		* 'aaseqs' (map to) is here [gi|N37351]
217		*/
218		// TODO use more suitable naming in AlignedCodonFrame
219	1	assertEquals(1, mapping.getAaSeqs().length);
220	1	assertSame(seq.getDatasetSequence(), mapping.getdnaSeqs()[0]);
221	1	assertEquals(1, mapping.getdnaSeqs().length);
222	1	assertSame(newseqs.get(0), mapping.getAaSeqs()[0]);
223	1	assertEquals(1, mapping.getdnaToProt().length);
224	1	assertEquals(2, mapping.getdnaToProt()[0].getFromRanges().size());
225		// the two spliced dna ranges are combined in one MapList
226	1	assertArrayEquals(new int[] { 12923, 13060 },
227		mapping.getdnaToProt()[0].getFromRanges().get(0));
228	1	assertArrayEquals(new int[] { 13411, 13550 },
229		mapping.getdnaToProt()[0].getFromRanges().get(1));
230	1	assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
231		// the two cdna ranges are merged into one contiguous region
232	1	assertArrayEquals(new int[] { 1, 278 },
233		mapping.getdnaToProt()[0].getToRanges().get(0));
234		}
235
		100% Uncovered Elements: 0 (26) Complexity: 1 Complexity Density: 0.04 1PASS
236	1	@Test(groups = "Functional")...
237		public void testGetDescription()
238		{
239	1	Gff3Helper testee = new Gff3Helper();
240	1	SequenceFeature sf = new SequenceFeature("type", "desc", 10, 20, 3f,
241		"group");
242	1	Map<String, List<String>> attributes = new HashMap<String, List<String>>();
243	1	assertNull(testee.getDescription(sf, attributes));
244
245		// ID if any is a fall-back for description
246	1	sf.setValue("ID", "Patrick");
247	1	assertEquals("Patrick", testee.getDescription(sf, attributes));
248
249		// Target is set by Exonerate
250	1	sf.setValue("Target", "Destination Moon");
251	1	assertEquals("Destination", testee.getDescription(sf, attributes));
252
253		// Ensembl variant feature - extract "alleles" value
254		// may be sequence_variant or a sub-type in the sequence ontology
255	1	sf = new SequenceFeature("feature_variant", "desc", 10, 20, 3f,
256		"group");
257	1	List<String> atts = new ArrayList<String>();
258	1	atts.add("A");
259	1	atts.add("C");
260	1	atts.add("T");
261	1	attributes.put("alleles", atts);
262	1	assertEquals("A,C,T", testee.getDescription(sf, attributes));
263
264		// Ensembl transcript or exon feature - extract Name
265	1	List<String> atts2 = new ArrayList<String>();
266	1	atts2.add("ENSE00001871077");
267	1	attributes.put("Name", atts2);
268	1	sf = new SequenceFeature("transcript", "desc", 10, 20, 3f, "group");
269	1	assertEquals("ENSE00001871077", testee.getDescription(sf, attributes));
270		// transcript sub-type in SO
271	1	sf = new SequenceFeature("mRNA", "desc", 10, 20, 3f, "group");
272	1	assertEquals("ENSE00001871077", testee.getDescription(sf, attributes));
273		// special usage of feature by Ensembl
274	1	sf = new SequenceFeature("NMD_transcript_variant", "desc", 10, 20, 3f,
275		"group");
276	1	assertEquals("ENSE00001871077", testee.getDescription(sf, attributes));
277		// exon feature
278	1	sf = new SequenceFeature("exon", "desc", 10, 20, 3f, "group");
279	1	assertEquals("ENSE00001871077", testee.getDescription(sf, attributes));
280		}
281		}