Classes

Class	Line #	Total Statements	Complexity	TOTAL Coverage	Actions
ExonerateHelperTest	51	126	7	0.00%	Show methods

Class ExonerateHelperTest

Class ExonerateHelperTest	Line # 51	Total Statements 126	Complexity 7	TOTAL Coverage 0.00%
setUpJvOptionPane() : void   setUpJvOptionPane() : void	5454	2.02	1.01	0.0 0.00%
testGetMappingType() : void   testGetMappingType() : void	6161	7.07	1.01	0.0 0.00%
testProcessGffSimilarity_protein2dna_forward_querygff() : void   testProcessGffSimilarity_protein2dna_forward_querygff() : void	9090	22.022	1.01	0.0 0.00%
testProcessGffSimilarity_protein2dna_reverse_querygff() : void   testProcessGffSimilarity_protein2dna_reverse_querygff() : void	133133	22.022	1.01	0.0 0.00%
testProcessGffSimilarity_protein2dna_forward_targetgff() : void   testProcessGffSimilarity_protein2dna_forward_targetgff() : void	176176	22.022	1.01	0.0 0.00%
testProcessGffSimilarity_protein2dna_reverse_targetgff() : void   testProcessGffSimilarity_protein2dna_reverse_targetgff() : void	222222	22.022	1.01	0.0 0.00%
testAddExonerateGffToAlignment() : void   testAddExonerateGffToAlignment() : void	265265	29.029	1.01	0.0 0.00%

 

Contributing tests

Source view

1		/*
2		* Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
3		* Copyright (C) $$Year-Rel$$ The Jalview Authors
4		*
5		* This file is part of Jalview.
6		*
7		* Jalview is free software: you can redistribute it and/or
8		* modify it under the terms of the GNU General Public License
9		* as published by the Free Software Foundation, either version 3
10		* of the License, or (at your option) any later version.
11		*
12		* Jalview is distributed in the hope that it will be useful, but
13		* WITHOUT ANY WARRANTY; without even the implied warranty
14		* of MERCHANTABILITY or FITNESS FOR A PARTICULAR
15		* PURPOSE. See the GNU General Public License for more details.
16		*
17		* You should have received a copy of the GNU General Public License
18		* along with Jalview. If not, see <http://www.gnu.org/licenses/>.
19		* The Jalview Authors are detailed in the 'AUTHORS' file.
20		*/
21		package jalview.io.gff;
22
23		import static org.testng.AssertJUnit.assertEquals;
24		import static org.testng.AssertJUnit.assertNull;
25		import static org.testng.AssertJUnit.assertSame;
26		import static org.testng.AssertJUnit.assertTrue;
27		import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals;
28
29		import jalview.datamodel.AlignedCodonFrame;
30		import jalview.datamodel.Alignment;
31		import jalview.datamodel.AlignmentI;
32		import jalview.datamodel.Mapping;
33		import jalview.datamodel.MappingType;
34		import jalview.datamodel.Sequence;
35		import jalview.datamodel.SequenceDummy;
36		import jalview.datamodel.SequenceI;
37		import jalview.gui.AlignFrame;
38		import jalview.gui.JvOptionPane;
39		import jalview.io.DataSourceType;
40		import jalview.io.FileLoader;
41
42		import java.io.IOException;
43		import java.util.ArrayList;
44		import java.util.Iterator;
45		import java.util.List;
46		import java.util.Map;
47
48		import org.testng.annotations.BeforeClass;
49		import org.testng.annotations.Test;
50
		0% Uncovered Elements: 133 (133) Complexity: 7 Complexity Density: 0.06
51		public class ExonerateHelperTest
52		{
53
		0% Uncovered Elements: 2 (2) Complexity: 1 Complexity Density: 0.5
54	0	@BeforeClass(alwaysRun = true)...
55		public void setUpJvOptionPane()
56		{
57	0	JvOptionPane.setInteractiveMode(false);
58	0	JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION);
59		}
60
		0% Uncovered Elements: 7 (7) Complexity: 1 Complexity Density: 0.14 4-
61	0	@Test(groups = "Functional")...
62		public void testGetMappingType()
63		{
64		// protein-to-dna:
65	0	assertSame(MappingType.PeptideToNucleotide, ExonerateHelper
66		.getMappingType("exonerate:protein2genome:local"));
67	0	assertSame(MappingType.PeptideToNucleotide,
68		ExonerateHelper.getMappingType("exonerate:protein2dna:local"));
69
70		// dna-to-dna:
71	0	assertSame(MappingType.NucleotideToNucleotide,
72		ExonerateHelper.getMappingType("coding2coding"));
73	0	assertSame(MappingType.NucleotideToNucleotide,
74		ExonerateHelper.getMappingType("coding2genome"));
75	0	assertSame(MappingType.NucleotideToNucleotide,
76		ExonerateHelper.getMappingType("cdna2genome"));
77	0	assertSame(MappingType.NucleotideToNucleotide,
78		ExonerateHelper.getMappingType("genome2genome"));
79	0	assertNull(ExonerateHelper.getMappingType("affine:local"));
80		}
81
82		/**
83		* Test processing one exonerate GFF line for the case where the mapping is
84		* protein2dna, similarity feature is on the query (the protein), match to the
85		* forward strand, target sequence is in neither the alignment nor the 'new
86		* sequences'
87		*
88		* @throws IOException
89		*/
		0% Uncovered Elements: 22 (22) Complexity: 1 Complexity Density: 0.05 4-
90	0	@Test(groups = "Functional")...
91		public void testProcessGffSimilarity_protein2dna_forward_querygff()
92		throws IOException
93		{
94	0	ExonerateHelper testee = new ExonerateHelper();
95	0	List<SequenceI> newseqs = new ArrayList<SequenceI>();
96	0	String[] gff = "Seq\texonerate:protein2dna:local\tsimilarity\t3\t10\t.\t+\t.\talignment_id 0 ; Target dna1 ; Align 3 400 8"
97		.split("\\t");
98	0	SequenceI seq = new Sequence("Seq", "PQRASTGKEEDVMIWCHQN");
99	0	seq.createDatasetSequence();
100	0	AlignmentI align = new Alignment(new SequenceI[] {});
101	0	Map<String, List<String>> set = Gff2Helper.parseNameValuePairs(gff[8]);
102
103		/*
104		* this should create a mapping from Seq2/3-10 to virtual sequence
105		* dna1 (added to newseqs) positions 400-423
106		*/
107	0	testee.processGffSimilarity(set, seq, gff, align, newseqs, false);
108	0	assertEquals(1, newseqs.size());
109	0	assertTrue(newseqs.get(0) instanceof SequenceDummy);
110	0	assertEquals("dna1", newseqs.get(0).getName());
111	0	assertEquals(1, align.getCodonFrames().size());
112	0	AlignedCodonFrame mapping = align.getCodonFrames().iterator().next();
113	0	assertEquals(1, mapping.getAaSeqs().length);
114	0	assertSame(seq.getDatasetSequence(), mapping.getAaSeqs()[0]);
115	0	assertEquals(1, mapping.getdnaSeqs().length);
116	0	assertSame(newseqs.get(0), mapping.getdnaSeqs()[0]);
117	0	assertEquals(1, mapping.getdnaToProt().length);
118	0	assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size());
119	0	assertArrayEquals(new int[] { 400, 423 },
120		mapping.getdnaToProt()[0].getFromRanges().get(0));
121	0	assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
122	0	assertArrayEquals(new int[] { 3, 10 },
123		mapping.getdnaToProt()[0].getToRanges().get(0));
124		}
125
126		/**
127		* Test processing one exonerate GFF line for the case where the mapping is
128		* protein2dna, similarity feature is on the query (the protein), match to the
129		* reverse strand
130		*
131		* @throws IOException
132		*/
		0% Uncovered Elements: 22 (22) Complexity: 1 Complexity Density: 0.05 4-
133	0	@Test(groups = "Functional")...
134		public void testProcessGffSimilarity_protein2dna_reverse_querygff()
135		throws IOException
136		{
137	0	ExonerateHelper testee = new ExonerateHelper();
138	0	List<SequenceI> newseqs = new ArrayList<SequenceI>();
139	0	String[] gff = "Seq\texonerate:protein2dna:local\tsimilarity\t3\t10\t0\t-\t.\talignment_id 0 ; Target dna1 ; Align 3 400 8"
140		.split("\\t");
141	0	SequenceI seq = new Sequence("Seq", "PQRASTGKEEDVMIWCHQN");
142	0	seq.createDatasetSequence();
143	0	AlignmentI align = new Alignment(new SequenceI[] {});
144	0	Map<String, List<String>> set = Gff2Helper.parseNameValuePairs(gff[8]);
145
146		/*
147		* this should create a mapping from Seq2/3-10 to virtual sequence
148		* dna1 (added to newseqs) positions 400-377 (reverse)
149		*/
150	0	testee.processGffSimilarity(set, seq, gff, align, newseqs, false);
151	0	assertEquals(1, newseqs.size());
152	0	assertTrue(newseqs.get(0) instanceof SequenceDummy);
153	0	assertEquals("dna1", newseqs.get(0).getName());
154	0	assertEquals(1, align.getCodonFrames().size());
155	0	AlignedCodonFrame mapping = align.getCodonFrames().iterator().next();
156	0	assertEquals(1, mapping.getAaSeqs().length);
157	0	assertSame(seq.getDatasetSequence(), mapping.getAaSeqs()[0]);
158	0	assertEquals(1, mapping.getdnaSeqs().length);
159	0	assertSame(newseqs.get(0), mapping.getdnaSeqs()[0]);
160	0	assertEquals(1, mapping.getdnaToProt().length);
161	0	assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size());
162	0	assertArrayEquals(new int[] { 400, 377 },
163		mapping.getdnaToProt()[0].getFromRanges().get(0));
164	0	assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
165	0	assertArrayEquals(new int[] { 3, 10 },
166		mapping.getdnaToProt()[0].getToRanges().get(0));
167		}
168
169		/**
170		* Test processing one exonerate GFF line for the case where the mapping is
171		* protein2dna, similarity feature is on the target (the dna), match to the
172		* forward strand
173		*
174		* @throws IOException
175		*/
		0% Uncovered Elements: 22 (22) Complexity: 1 Complexity Density: 0.05 4-
176	0	@Test(groups = "Functional")...
177		public void testProcessGffSimilarity_protein2dna_forward_targetgff()
178		throws IOException
179		{
180	0	ExonerateHelper testee = new ExonerateHelper();
181	0	List<SequenceI> newseqs = new ArrayList<SequenceI>();
182	0	String[] gff = "dna1\texonerate:protein2dna:local\tsimilarity\t400\t423\t0\t+\t.\talignment_id 0 ; Query Prot1 ; Align 400 3 24"
183		.split("\\t");
184	0	SequenceI seq = new Sequence("dna1/391-430",
185		"CGATCCGATCCGATCCGATCCGATCCGATCCGATCCGATC");
186	0	seq.createDatasetSequence();
187	0	AlignmentI align = new Alignment(new SequenceI[] { seq });
188		// GFF feature on the target describes mapping from base 400 for
189		// count 24 to position 3
190	0	Map<String, List<String>> set = Gff2Helper.parseNameValuePairs(gff[8]);
191
192		/*
193		* this should create a mapping from virtual sequence dna1 (added to
194		* newseqs) positions 400-423 to Prot1/3-10
195		*/
196	0	testee.processGffSimilarity(set, seq, gff, align, newseqs, false);
197	0	assertEquals(1, newseqs.size());
198	0	assertTrue(newseqs.get(0) instanceof SequenceDummy);
199	0	assertEquals("Prot1", newseqs.get(0).getName());
200	0	assertEquals(1, align.getCodonFrames().size());
201	0	AlignedCodonFrame mapping = align.getCodonFrames().iterator().next();
202	0	assertEquals(1, mapping.getAaSeqs().length);
203	0	assertSame(newseqs.get(0), mapping.getAaSeqs()[0]);
204	0	assertSame(seq.getDatasetSequence(), mapping.getdnaSeqs()[0]);
205	0	assertEquals(1, mapping.getdnaSeqs().length);
206	0	assertEquals(1, mapping.getdnaToProt().length);
207	0	assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size());
208	0	assertArrayEquals(new int[] { 400, 423 },
209		mapping.getdnaToProt()[0].getFromRanges().get(0));
210	0	assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
211	0	assertArrayEquals(new int[] { 3, 10 },
212		mapping.getdnaToProt()[0].getToRanges().get(0));
213		}
214
215		/**
216		* Test processing one exonerate GFF line for the case where the mapping is
217		* protein2dna, similarity feature is on the target (the dna), match to the
218		* reverse strand
219		*
220		* @throws IOException
221		*/
		0% Uncovered Elements: 22 (22) Complexity: 1 Complexity Density: 0.05 4-
222	0	@Test(groups = "Functional")...
223		public void testProcessGffSimilarity_protein2dna_reverse_targetgff()
224		throws IOException
225		{
226	0	ExonerateHelper testee = new ExonerateHelper();
227	0	List<SequenceI> newseqs = new ArrayList<SequenceI>();
228	0	String[] gff = "dna1\texonerate:protein2dna:local\tsimilarity\t377\t400\t0\t-\t.\talignment_id 0 ; Query Prot1 ; Align 400 3 24"
229		.split("\\t");
230	0	SequenceI seq = new Sequence("dna1/371-410",
231		"CGATCCGATCCGATCCGATCCGATCCGATCCGATCCGATC");
232	0	seq.createDatasetSequence();
233	0	AlignmentI align = new Alignment(new SequenceI[] { seq });
234		// GFF feature on the target describes mapping from base 400 for
235		// count 24 to position 3
236	0	Map<String, List<String>> set = Gff2Helper.parseNameValuePairs(gff[8]);
237
238		/*
239		* this should create a mapping from virtual sequence dna1 (added to
240		* newseqs) positions 400-377 (reverse) to Prot1/3-10
241		*/
242	0	testee.processGffSimilarity(set, seq, gff, align, newseqs, false);
243	0	assertEquals(1, newseqs.size());
244	0	assertTrue(newseqs.get(0) instanceof SequenceDummy);
245	0	assertEquals("Prot1", newseqs.get(0).getName());
246	0	assertEquals(1, align.getCodonFrames().size());
247	0	AlignedCodonFrame mapping = align.getCodonFrames().iterator().next();
248	0	assertEquals(1, mapping.getAaSeqs().length);
249	0	assertSame(newseqs.get(0), mapping.getAaSeqs()[0]);
250	0	assertSame(seq.getDatasetSequence(), mapping.getdnaSeqs()[0]);
251	0	assertEquals(1, mapping.getdnaSeqs().length);
252	0	assertEquals(1, mapping.getdnaToProt().length);
253	0	assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size());
254	0	assertArrayEquals(new int[] { 400, 377 },
255		mapping.getdnaToProt()[0].getFromRanges().get(0));
256	0	assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
257	0	assertArrayEquals(new int[] { 3, 10 },
258		mapping.getdnaToProt()[0].getToRanges().get(0));
259		}
260
261		/**
262		* Tests loading exonerate GFF2 output, including 'similarity' alignment
263		* feature, on to sequences
264		*/
		0% Uncovered Elements: 29 (29) Complexity: 1 Complexity Density: 0.03 4-
265	0	@Test(groups = { "Functional" })...
266		public void testAddExonerateGffToAlignment()
267		{
268	0	FileLoader loader = new FileLoader(false);
269	0	AlignFrame af = loader.LoadFileWaitTillLoaded(
270		"examples/testdata/exonerateseqs.fa", DataSourceType.FILE);
271
272	0	af.loadJalviewDataFile("examples/testdata/exonerateoutput.gff",
273		DataSourceType.FILE, null, null);
274
275		/*
276		* verify one mapping to a dummy sequence, one to a real one
277		*/
278	0	List<AlignedCodonFrame> mappings = af.getViewport().getAlignment()
279		.getDataset().getCodonFrames();
280	0	assertEquals(2, mappings.size());
281	0	Iterator<AlignedCodonFrame> iter = mappings.iterator();
282
283		// first mapping is to dummy sequence
284	0	AlignedCodonFrame mapping = iter.next();
285	0	Mapping[] mapList = mapping.getProtMappings();
286	0	assertEquals(1, mapList.length);
287	0	assertTrue(mapList[0].getTo() instanceof SequenceDummy);
288	0	assertEquals("DDB_G0269124", mapList[0].getTo().getName());
289
290		// 143 in protein should map to codon [11270, 11269, 11268] in dna
291	0	int[] mappedRegion = mapList[0].getMap().locateInFrom(143, 143);
292	0	assertArrayEquals(new int[] { 11270, 11268 }, mappedRegion);
293
294		// second mapping is to a sequence in the alignment
295	0	mapping = iter.next();
296	0	mapList = mapping.getProtMappings();
297	0	assertEquals(1, mapList.length);
298	0	SequenceI proteinSeq = af.getViewport().getAlignment()
299		.findName("DDB_G0280897");
300	0	assertSame(proteinSeq.getDatasetSequence(), mapList[0].getTo());
301	0	assertEquals(1, mapping.getdnaToProt().length);
302
303		// 143 in protein should map to codon [11270, 11269, 11268] in dna
304	0	mappedRegion = mapList[0].getMap().locateInFrom(143, 143);
305	0	assertArrayEquals(new int[] { 11270, 11268 }, mappedRegion);
306
307		// 182 in protein should map to codon [11153, 11152, 11151] in dna
308	0	mappedRegion = mapList[0].getMap().locateInFrom(182, 182);
309	0	assertArrayEquals(new int[] { 11153, 11151 }, mappedRegion);
310
311		// and the reverse mapping:
312	0	mappedRegion = mapList[0].getMap().locateInTo(11151, 11153);
313	0	assertArrayEquals(new int[] { 182, 182 }, mappedRegion);
314
315		// 11150 in dna should _not_ map to protein
316	0	mappedRegion = mapList[0].getMap().locateInTo(11150, 11150);
317	0	assertNull(mappedRegion);
318
319		// similarly 183 in protein should _not_ map to dna
320	0	mappedRegion = mapList[0].getMap().locateInFrom(183, 183);
321	0	assertNull(mappedRegion);
322		}
323		}