| 1 |
|
|
| 2 |
|
|
| 3 |
|
|
| 4 |
|
|
| 5 |
|
|
| 6 |
|
|
| 7 |
|
|
| 8 |
|
|
| 9 |
|
|
| 10 |
|
|
| 11 |
|
|
| 12 |
|
|
| 13 |
|
|
| 14 |
|
|
| 15 |
|
|
| 16 |
|
|
| 17 |
|
|
| 18 |
|
|
| 19 |
|
|
| 20 |
|
|
| 21 |
|
package jalview.datamodel; |
| 22 |
|
|
| 23 |
|
import static org.testng.AssertJUnit.assertEquals; |
| 24 |
|
import static org.testng.AssertJUnit.assertFalse; |
| 25 |
|
import static org.testng.AssertJUnit.assertNotNull; |
| 26 |
|
import static org.testng.AssertJUnit.assertNotSame; |
| 27 |
|
import static org.testng.AssertJUnit.assertNull; |
| 28 |
|
import static org.testng.AssertJUnit.assertSame; |
| 29 |
|
import static org.testng.AssertJUnit.assertTrue; |
| 30 |
|
|
| 31 |
|
import java.io.File; |
| 32 |
|
import java.util.ArrayList; |
| 33 |
|
import java.util.Arrays; |
| 34 |
|
import java.util.BitSet; |
| 35 |
|
import java.util.Iterator; |
| 36 |
|
import java.util.List; |
| 37 |
|
import java.util.Locale; |
| 38 |
|
import java.util.Vector; |
| 39 |
|
|
| 40 |
|
import org.testng.Assert; |
| 41 |
|
import org.testng.annotations.BeforeClass; |
| 42 |
|
import org.testng.annotations.BeforeMethod; |
| 43 |
|
import org.testng.annotations.Test; |
| 44 |
|
|
| 45 |
|
import jalview.analysis.AlignmentGenerator; |
| 46 |
|
import jalview.bin.Cache; |
| 47 |
|
import jalview.commands.EditCommand; |
| 48 |
|
import jalview.commands.EditCommand.Action; |
| 49 |
|
import jalview.datamodel.PDBEntry.Type; |
| 50 |
|
import jalview.gui.JvOptionPane; |
| 51 |
|
import jalview.util.MapList; |
| 52 |
|
import junit.extensions.PA; |
| 53 |
|
|
| |
|
| 97% |
Uncovered Elements: 37 (1,231) |
Complexity: 57 |
Complexity Density: 0.05 |
|
| 54 |
|
public class SequenceTest |
| 55 |
|
{ |
| |
|
| 100% |
Uncovered Elements: 0 (2) |
Complexity: 1 |
Complexity Density: 0.5 |
|
| 56 |
1 |
@BeforeClass(alwaysRun = true)... |
| 57 |
|
public void setUpJvOptionPane() |
| 58 |
|
{ |
| 59 |
1 |
JvOptionPane.setInteractiveMode(false); |
| 60 |
1 |
JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION); |
| 61 |
|
} |
| 62 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (1) |
Complexity: 1 |
Complexity Density: 1 |
|
| 63 |
47 |
@BeforeMethod(alwaysRun = true)... |
| 64 |
|
public void loadProperties() |
| 65 |
|
{ |
| 66 |
47 |
Cache.loadProperties("test/jalview/util/comparisonTestProps.jvprops"); |
| 67 |
|
} |
| 68 |
|
|
| 69 |
|
Sequence seq; |
| 70 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (1) |
Complexity: 1 |
Complexity Density: 1 |
|
| 71 |
47 |
@BeforeMethod(alwaysRun = true)... |
| 72 |
|
public void setUp() |
| 73 |
|
{ |
| 74 |
47 |
seq = new Sequence("FER1", "AKPNGVL"); |
| 75 |
|
} |
| 76 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (16) |
Complexity: 1 |
Complexity Density: 0.06 |
1PASS
|
|
| 77 |
1 |
@Test(groups = { "Functional" })... |
| 78 |
|
public void testInsertGapsAndGapmaps() |
| 79 |
|
{ |
| 80 |
1 |
SequenceI aseq = seq.deriveSequence(); |
| 81 |
1 |
aseq.insertCharAt(2, 3, '-'); |
| 82 |
1 |
aseq.insertCharAt(6, 3, '-'); |
| 83 |
1 |
assertEquals("Gap insertions not correct", "AK---P---NGVL", |
| 84 |
|
aseq.getSequenceAsString()); |
| 85 |
1 |
List<int[]> gapInt = aseq.getInsertions(); |
| 86 |
1 |
assertEquals("Gap interval 1 start wrong", 2, gapInt.get(0)[0]); |
| 87 |
1 |
assertEquals("Gap interval 1 end wrong", 4, gapInt.get(0)[1]); |
| 88 |
1 |
assertEquals("Gap interval 2 start wrong", 6, gapInt.get(1)[0]); |
| 89 |
1 |
assertEquals("Gap interval 2 end wrong", 8, gapInt.get(1)[1]); |
| 90 |
|
|
| 91 |
1 |
BitSet gapfield = aseq.getInsertionsAsBits(); |
| 92 |
1 |
BitSet expectedgaps = new BitSet(); |
| 93 |
1 |
expectedgaps.set(2, 5); |
| 94 |
1 |
expectedgaps.set(6, 9); |
| 95 |
|
|
| 96 |
1 |
assertEquals(6, expectedgaps.cardinality()); |
| 97 |
|
|
| 98 |
1 |
assertEquals("getInsertionsAsBits didn't mark expected number of gaps", |
| 99 |
|
6, gapfield.cardinality()); |
| 100 |
|
|
| 101 |
1 |
assertEquals("getInsertionsAsBits not correct.", expectedgaps, |
| 102 |
|
gapfield); |
| 103 |
|
} |
| 104 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (6) |
Complexity: 1 |
Complexity Density: 0.17 |
1PASS
|
|
| 105 |
1 |
@Test(groups = ("Functional"))... |
| 106 |
|
public void testIsProtein() |
| 107 |
|
{ |
| 108 |
|
|
| 109 |
1 |
assertTrue(new Sequence("prot", "ASDFASDFASDF").isProtein()); |
| 110 |
|
|
| 111 |
1 |
assertFalse(new Sequence("prot", "ACGTACGTACGT").isProtein()); |
| 112 |
|
|
| 113 |
1 |
SequenceI sq = new Sequence("prot", "ACGUACGUACGU"); |
| 114 |
1 |
assertFalse(sq.isProtein()); |
| 115 |
|
|
| 116 |
1 |
sq.setSequence("ASDFASDFADSF"); |
| 117 |
1 |
assertTrue(sq.isProtein()); |
| 118 |
|
} |
| 119 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (9) |
Complexity: 1 |
Complexity Density: 0.11 |
1PASS
|
|
| 120 |
1 |
@Test(groups = ("Functional"))... |
| 121 |
|
public void testIsProteinWithXorNAmbiguityCodes() |
| 122 |
|
{ |
| 123 |
|
|
| 124 |
1 |
assertTrue(new Sequence("prot", "ASDFASDFASDFNNNNNNNNN").isProtein()); |
| 125 |
1 |
assertTrue(new Sequence("prot", "NNNNNNNNNNNNNNNNNNNNN").isProtein()); |
| 126 |
|
|
| 127 |
1 |
assertTrue(new Sequence("prot", "ASDFASDFASDFXXXXXXXXX").isProtein()); |
| 128 |
|
|
| 129 |
1 |
assertFalse(new Sequence("prot", "ACGTACGTACGTXXXXXXXX").isProtein()); |
| 130 |
|
|
| 131 |
|
|
| 132 |
1 |
assertTrue(new Sequence("prot", "ACGTACGTACGTXN").isProtein()); |
| 133 |
|
|
| 134 |
1 |
assertFalse(new Sequence("prot", "ACGTACGTACGTNNNNNNNN").isProtein()); |
| 135 |
|
|
| 136 |
1 |
assertFalse(new Sequence("prot", "ACGUACGUACGUACTGACAXX").isProtein()); |
| 137 |
1 |
assertFalse(new Sequence("prot", "ACGUACGUACGUXXXXXXXXX").isProtein()); |
| 138 |
1 |
assertFalse(new Sequence("prot", "ACGUACGUACGUNNNNNNNNN").isProtein()); |
| 139 |
|
} |
| 140 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (7) |
Complexity: 1 |
Complexity Density: 0.14 |
1PASS
|
|
| 141 |
1 |
@Test(groups = { "Functional" })... |
| 142 |
|
public void testGetAnnotation() |
| 143 |
|
{ |
| 144 |
|
|
| 145 |
1 |
assertNull(seq.getAnnotation()); |
| 146 |
1 |
AlignmentAnnotation ann = addAnnotation("label1", "desc1", "calcId1", |
| 147 |
|
1f); |
| 148 |
1 |
AlignmentAnnotation[] anns = seq.getAnnotation(); |
| 149 |
1 |
assertEquals(1, anns.length); |
| 150 |
1 |
assertSame(ann, anns[0]); |
| 151 |
|
|
| 152 |
|
|
| 153 |
1 |
seq.removeAlignmentAnnotation(ann); |
| 154 |
1 |
assertNull(seq.getAnnotation()); |
| 155 |
|
} |
| 156 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (7) |
Complexity: 1 |
Complexity Density: 0.14 |
1PASS
|
|
| 157 |
1 |
@Test(groups = { "Functional" })... |
| 158 |
|
public void testGetAnnotation_forLabel() |
| 159 |
|
{ |
| 160 |
1 |
AlignmentAnnotation ann1 = addAnnotation("label1", "desc1", "calcId1", |
| 161 |
|
1f); |
| 162 |
1 |
addAnnotation("label2", "desc2", "calcId2", 1f); |
| 163 |
1 |
AlignmentAnnotation ann3 = addAnnotation("label1", "desc3", "calcId3", |
| 164 |
|
1f); |
| 165 |
1 |
AlignmentAnnotation[] anns = seq.getAnnotation("label1"); |
| 166 |
1 |
assertEquals(2, anns.length); |
| 167 |
1 |
assertSame(ann1, anns[0]); |
| 168 |
1 |
assertSame(ann3, anns[1]); |
| 169 |
|
} |
| 170 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (4) |
Complexity: 1 |
Complexity Density: 0.25 |
|
| 171 |
16 |
private AlignmentAnnotation addAnnotation(String label,... |
| 172 |
|
String description, String calcId, float value) |
| 173 |
|
{ |
| 174 |
16 |
final AlignmentAnnotation annotation = new AlignmentAnnotation(label, |
| 175 |
|
description, value); |
| 176 |
16 |
annotation.setCalcId(calcId); |
| 177 |
16 |
seq.addAlignmentAnnotation(annotation); |
| 178 |
16 |
return annotation; |
| 179 |
|
} |
| 180 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (15) |
Complexity: 1 |
Complexity Density: 0.07 |
1PASS
|
|
| 181 |
1 |
@Test(groups = { "Functional" })... |
| 182 |
|
public void testGetAlignmentAnnotations_forCalcIdAndLabel() |
| 183 |
|
{ |
| 184 |
1 |
addAnnotation("label1", "desc1", "calcId1", 1f); |
| 185 |
1 |
AlignmentAnnotation ann2 = addAnnotation("label2", "desc2", "calcId2", |
| 186 |
|
1f); |
| 187 |
1 |
addAnnotation("label2", "desc3", "calcId3", 1f); |
| 188 |
1 |
AlignmentAnnotation ann4 = addAnnotation("label2", "desc3", "calcId2", |
| 189 |
|
1f); |
| 190 |
1 |
addAnnotation("label5", "desc3", null, 1f); |
| 191 |
1 |
addAnnotation(null, "desc3", "calcId3", 1f); |
| 192 |
|
|
| 193 |
1 |
List<AlignmentAnnotation> anns = seq.getAlignmentAnnotations("calcId2", |
| 194 |
|
"label2"); |
| 195 |
1 |
assertEquals(2, anns.size()); |
| 196 |
1 |
assertSame(ann2, anns.get(0)); |
| 197 |
1 |
assertSame(ann4, anns.get(1)); |
| 198 |
|
|
| 199 |
1 |
assertTrue(seq.getAlignmentAnnotations("calcId2", "label3").isEmpty()); |
| 200 |
1 |
assertTrue(seq.getAlignmentAnnotations("calcId3", "label5").isEmpty()); |
| 201 |
1 |
assertTrue(seq.getAlignmentAnnotations("calcId2", null).isEmpty()); |
| 202 |
1 |
assertTrue(seq.getAlignmentAnnotations(null, "label3").isEmpty()); |
| 203 |
1 |
assertTrue(seq.getAlignmentAnnotations(null, null).isEmpty()); |
| 204 |
|
} |
| 205 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (15) |
Complexity: 1 |
Complexity Density: 0.07 |
1PASS
|
|
| 206 |
1 |
@Test(groups = { "Functional" })... |
| 207 |
|
public void testGetAlignmentAnnotations_forCalcIdLabelAndDescription() |
| 208 |
|
{ |
| 209 |
1 |
addAnnotation("label1", "desc1", "calcId1", 1f); |
| 210 |
1 |
AlignmentAnnotation ann2 = addAnnotation("label2", "desc2", "calcId2", |
| 211 |
|
1f); |
| 212 |
1 |
addAnnotation("label2", "desc3", "calcId3", 1f); |
| 213 |
1 |
AlignmentAnnotation ann4 = addAnnotation("label2", "desc3", "calcId2", |
| 214 |
|
1f); |
| 215 |
1 |
addAnnotation("label5", "desc3", null, 1f); |
| 216 |
1 |
addAnnotation(null, "desc3", "calcId3", 1f); |
| 217 |
|
|
| 218 |
1 |
List<AlignmentAnnotation> anns = seq.getAlignmentAnnotations("calcId2", |
| 219 |
|
"label2", "desc3"); |
| 220 |
1 |
assertEquals(1, anns.size()); |
| 221 |
1 |
assertSame(ann4, anns.get(0)); |
| 222 |
|
|
| 223 |
|
|
| 224 |
|
|
| 225 |
1 |
assertTrue(seq.getAlignmentAnnotations("calcId3", "label2", null) |
| 226 |
|
.isEmpty()); |
| 227 |
|
|
| 228 |
1 |
assertTrue(seq.getAlignmentAnnotations("calcId2", "label3", null) |
| 229 |
|
.isEmpty()); |
| 230 |
1 |
assertTrue(seq.getAlignmentAnnotations("calcId3", "label5", null) |
| 231 |
|
.isEmpty()); |
| 232 |
1 |
assertTrue( |
| 233 |
|
seq.getAlignmentAnnotations("calcId2", null, null).isEmpty()); |
| 234 |
1 |
assertTrue(seq.getAlignmentAnnotations(null, "label3", null).isEmpty()); |
| 235 |
1 |
assertTrue(seq.getAlignmentAnnotations(null, null, null).isEmpty()); |
| 236 |
|
} |
| 237 |
|
|
| 238 |
|
|
| 239 |
|
|
| 240 |
|
|
| 241 |
|
|
| 242 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (18) |
Complexity: 1 |
Complexity Density: 0.06 |
1PASS
|
|
| 243 |
1 |
@Test(groups = { "Functional" })... |
| 244 |
|
public void testAddAlignmentAnnotation() |
| 245 |
|
{ |
| 246 |
1 |
assertNull(seq.getAnnotation()); |
| 247 |
1 |
final AlignmentAnnotation annotation = new AlignmentAnnotation("a", "b", |
| 248 |
|
2d); |
| 249 |
1 |
assertNull(annotation.sequenceRef); |
| 250 |
1 |
seq.addAlignmentAnnotation(annotation); |
| 251 |
1 |
assertSame(seq, annotation.sequenceRef); |
| 252 |
1 |
AlignmentAnnotation[] anns = seq.getAnnotation(); |
| 253 |
1 |
assertEquals(1, anns.length); |
| 254 |
1 |
assertSame(annotation, anns[0]); |
| 255 |
|
|
| 256 |
|
|
| 257 |
1 |
seq.addAlignmentAnnotation(annotation); |
| 258 |
1 |
anns = seq.getAnnotation(); |
| 259 |
1 |
assertEquals(1, anns.length); |
| 260 |
1 |
assertSame(annotation, anns[0]); |
| 261 |
|
|
| 262 |
|
|
| 263 |
1 |
final AlignmentAnnotation annotation2 = new AlignmentAnnotation("a", |
| 264 |
|
"b", 2d); |
| 265 |
1 |
seq.addAlignmentAnnotation(annotation2); |
| 266 |
1 |
anns = seq.getAnnotation(); |
| 267 |
1 |
assertEquals(2, anns.length); |
| 268 |
1 |
assertSame(annotation, anns[0]); |
| 269 |
1 |
assertSame(annotation2, anns[1]); |
| 270 |
|
} |
| 271 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (9) |
Complexity: 1 |
Complexity Density: 0.11 |
1PASS
|
|
| 272 |
1 |
@Test(groups = { "Functional" })... |
| 273 |
|
public void testGetStartGetEnd() |
| 274 |
|
{ |
| 275 |
1 |
SequenceI sq = new Sequence("test", "ABCDEF"); |
| 276 |
1 |
assertEquals(1, sq.getStart()); |
| 277 |
1 |
assertEquals(6, sq.getEnd()); |
| 278 |
|
|
| 279 |
1 |
sq = new Sequence("test", "--AB-C-DEF--"); |
| 280 |
1 |
assertEquals(1, sq.getStart()); |
| 281 |
1 |
assertEquals(6, sq.getEnd()); |
| 282 |
|
|
| 283 |
1 |
sq = new Sequence("test", "----"); |
| 284 |
1 |
assertEquals(1, sq.getStart()); |
| 285 |
1 |
assertEquals(0, sq.getEnd()); |
| 286 |
|
} |
| 287 |
|
|
| 288 |
|
|
| 289 |
|
|
| 290 |
|
|
| 291 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (37) |
Complexity: 1 |
Complexity Density: 0.03 |
1PASS
|
|
| 292 |
1 |
@Test(groups = { "Functional" })... |
| 293 |
|
public void testFindIndex() |
| 294 |
|
{ |
| 295 |
|
|
| 296 |
|
|
| 297 |
|
|
| 298 |
|
|
| 299 |
1 |
SequenceI sq = new Sequence("test", "ABCDEF"); |
| 300 |
1 |
assertEquals(0, sq.findIndex(0)); |
| 301 |
1 |
sq.sequenceChanged(); |
| 302 |
1 |
assertEquals(1, sq.findIndex(1)); |
| 303 |
1 |
sq.sequenceChanged(); |
| 304 |
1 |
assertEquals(5, sq.findIndex(5)); |
| 305 |
1 |
sq.sequenceChanged(); |
| 306 |
1 |
assertEquals(6, sq.findIndex(6)); |
| 307 |
1 |
sq.sequenceChanged(); |
| 308 |
1 |
assertEquals(6, sq.findIndex(9)); |
| 309 |
|
|
| 310 |
1 |
final String aligned = "-A--B-C-D-E-F--"; |
| 311 |
1 |
assertEquals(15, aligned.length()); |
| 312 |
1 |
sq = new Sequence("test/8-13", aligned); |
| 313 |
1 |
assertEquals(2, sq.findIndex(8)); |
| 314 |
1 |
sq.sequenceChanged(); |
| 315 |
1 |
assertEquals(5, sq.findIndex(9)); |
| 316 |
1 |
sq.sequenceChanged(); |
| 317 |
1 |
assertEquals(7, sq.findIndex(10)); |
| 318 |
|
|
| 319 |
|
|
| 320 |
1 |
sq.sequenceChanged(); |
| 321 |
1 |
assertEquals(0, sq.findIndex(0)); |
| 322 |
1 |
sq.sequenceChanged(); |
| 323 |
1 |
assertEquals(0, sq.findIndex(-1)); |
| 324 |
|
|
| 325 |
|
|
| 326 |
1 |
sq.sequenceChanged(); |
| 327 |
1 |
assertEquals(13, sq.findIndex(99)); |
| 328 |
|
|
| 329 |
|
|
| 330 |
|
|
| 331 |
|
|
| 332 |
|
|
| 333 |
1 |
sq = new Sequence("test/8-15", "A-B-C-"); |
| 334 |
1 |
assertEquals(6, sq.getLength()); |
| 335 |
1 |
sq.sequenceChanged(); |
| 336 |
1 |
assertEquals(sq.getLength(), sq.findIndex(14)); |
| 337 |
1 |
sq = new Sequence("test/8-99", "-A--B-C-D"); |
| 338 |
1 |
sq.sequenceChanged(); |
| 339 |
1 |
assertEquals(sq.getLength(), sq.findIndex(65)); |
| 340 |
|
|
| 341 |
|
|
| 342 |
|
|
| 343 |
|
|
| 344 |
|
|
| 345 |
1 |
sq = new Sequence("test/8-15", "-A-B-C-"); |
| 346 |
1 |
sq.sequenceChanged(); |
| 347 |
1 |
assertEquals(0, sq.findIndex(3)); |
| 348 |
1 |
sq = new Sequence("test/8-15", "A-B-C-"); |
| 349 |
1 |
sq.sequenceChanged(); |
| 350 |
1 |
assertEquals(0, sq.findIndex(2)); |
| 351 |
|
} |
| 352 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (22) |
Complexity: 1 |
Complexity Density: 0.05 |
1PASS
|
|
| 353 |
1 |
@Test(groups = { "Functional" })... |
| 354 |
|
public void testFindPositions() |
| 355 |
|
{ |
| 356 |
1 |
SequenceI sq = new Sequence("test/8-13", "-ABC---DE-F--"); |
| 357 |
|
|
| 358 |
|
|
| 359 |
|
|
| 360 |
|
|
| 361 |
1 |
assertNull(sq.findPositions(6, 5)); |
| 362 |
1 |
assertNull(sq.findPositions(0, 5)); |
| 363 |
1 |
assertNull(sq.findPositions(-1, 5)); |
| 364 |
|
|
| 365 |
|
|
| 366 |
|
|
| 367 |
|
|
| 368 |
1 |
assertNull(sq.findPositions(1, 1)); |
| 369 |
1 |
assertNull(sq.findPositions(5, 5)); |
| 370 |
1 |
assertNull(sq.findPositions(5, 6)); |
| 371 |
1 |
assertNull(sq.findPositions(5, 7)); |
| 372 |
|
|
| 373 |
|
|
| 374 |
|
|
| 375 |
|
|
| 376 |
1 |
assertEquals(new Range(8, 8), sq.findPositions(2, 2)); |
| 377 |
1 |
assertEquals(new Range(8, 9), sq.findPositions(2, 3)); |
| 378 |
1 |
assertEquals(new Range(8, 10), sq.findPositions(2, 4)); |
| 379 |
1 |
assertEquals(new Range(9, 10), sq.findPositions(3, 4)); |
| 380 |
|
|
| 381 |
|
|
| 382 |
|
|
| 383 |
|
|
| 384 |
1 |
assertEquals(new Range(8, 10), sq.findPositions(1, 4)); |
| 385 |
1 |
assertEquals(new Range(11, 12), sq.findPositions(6, 9)); |
| 386 |
|
|
| 387 |
|
|
| 388 |
|
|
| 389 |
|
|
| 390 |
1 |
assertEquals(new Range(10, 10), sq.findPositions(4, 5)); |
| 391 |
1 |
assertEquals(new Range(9, 13), sq.findPositions(3, 11)); |
| 392 |
|
|
| 393 |
|
|
| 394 |
|
|
| 395 |
|
|
| 396 |
1 |
assertEquals(new Range(10, 11), sq.findPositions(4, 8)); |
| 397 |
1 |
assertEquals(new Range(8, 13), sq.findPositions(2, 11)); |
| 398 |
|
|
| 399 |
|
|
| 400 |
|
|
| 401 |
|
|
| 402 |
1 |
assertEquals(new Range(8, 10), sq.findPositions(1, 5)); |
| 403 |
1 |
assertEquals(new Range(11, 12), sq.findPositions(5, 10)); |
| 404 |
1 |
assertEquals(new Range(8, 13), sq.findPositions(1, 13)); |
| 405 |
1 |
assertEquals(new Range(8, 13), sq.findPositions(1, 99)); |
| 406 |
|
} |
| 407 |
|
|
| 408 |
|
|
| 409 |
|
|
| 410 |
|
|
| 411 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (97) |
Complexity: 1 |
Complexity Density: 0.01 |
1PASS
|
|
| 412 |
1 |
@Test(groups = { "Functional" })... |
| 413 |
|
public void testFindPosition() |
| 414 |
|
{ |
| 415 |
|
|
| 416 |
|
|
| 417 |
|
|
| 418 |
|
|
| 419 |
1 |
SequenceI sq = new Sequence("test/8-13", "ABCDEF"); |
| 420 |
1 |
assertEquals(8, sq.findPosition(0)); |
| 421 |
|
|
| 422 |
1 |
assertEquals("test:Pos8:Col1:startCol1:endCol0:tok1", |
| 423 |
|
PA.getValue(sq, "cursor").toString()); |
| 424 |
1 |
SequenceCursor cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 425 |
1 |
int token = (int) PA.getValue(sq, "changeCount"); |
| 426 |
1 |
assertEquals(new SequenceCursor(sq, 8, 1, token), cursor); |
| 427 |
|
|
| 428 |
1 |
sq.sequenceChanged(); |
| 429 |
|
|
| 430 |
|
|
| 431 |
|
|
| 432 |
|
|
| 433 |
|
|
| 434 |
1 |
assertEquals(13, sq.findPosition(5)); |
| 435 |
1 |
cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 436 |
1 |
assertEquals(++token, (int) PA.getValue(sq, "changeCount")); |
| 437 |
1 |
assertEquals(new SequenceCursor(sq, 13, 6, token), cursor); |
| 438 |
1 |
assertEquals("test:Pos13:Col6:startCol1:endCol6:tok2", |
| 439 |
|
PA.getValue(sq, "cursor").toString()); |
| 440 |
|
|
| 441 |
|
|
| 442 |
|
|
| 443 |
1 |
sq = new Sequence("test/8-11", "AB-C-D--"); |
| 444 |
1 |
token = (int) PA.getValue(sq, "changeCount"); |
| 445 |
1 |
assertEquals(8, sq.findPosition(0)); |
| 446 |
1 |
cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 447 |
1 |
assertEquals(new SequenceCursor(sq, 8, 1, token), cursor); |
| 448 |
1 |
assertEquals("test:Pos8:Col1:startCol1:endCol0:tok1", |
| 449 |
|
PA.getValue(sq, "cursor").toString()); |
| 450 |
|
|
| 451 |
1 |
sq.sequenceChanged(); |
| 452 |
1 |
assertEquals(9, sq.findPosition(1)); |
| 453 |
1 |
cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 454 |
1 |
assertEquals(new SequenceCursor(sq, 9, 2, ++token), cursor); |
| 455 |
1 |
assertEquals("test:Pos9:Col2:startCol1:endCol0:tok2", |
| 456 |
|
PA.getValue(sq, "cursor").toString()); |
| 457 |
|
|
| 458 |
1 |
sq.sequenceChanged(); |
| 459 |
|
|
| 460 |
|
|
| 461 |
1 |
assertEquals(10, sq.findPosition(2)); |
| 462 |
1 |
cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 463 |
1 |
assertEquals(new SequenceCursor(sq, 9, 2, ++token), cursor); |
| 464 |
1 |
assertEquals("test:Pos9:Col2:startCol1:endCol0:tok3", |
| 465 |
|
PA.getValue(sq, "cursor").toString()); |
| 466 |
|
|
| 467 |
1 |
sq.sequenceChanged(); |
| 468 |
1 |
assertEquals(10, sq.findPosition(3)); |
| 469 |
1 |
cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 470 |
1 |
assertEquals(new SequenceCursor(sq, 10, 4, ++token), cursor); |
| 471 |
1 |
assertEquals("test:Pos10:Col4:startCol1:endCol0:tok4", |
| 472 |
|
PA.getValue(sq, "cursor").toString()); |
| 473 |
|
|
| 474 |
1 |
sq.sequenceChanged(); |
| 475 |
|
|
| 476 |
|
|
| 477 |
1 |
assertEquals(11, sq.findPosition(4)); |
| 478 |
1 |
cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 479 |
1 |
assertEquals(new SequenceCursor(sq, 10, 4, ++token), cursor); |
| 480 |
1 |
assertEquals("test:Pos10:Col4:startCol1:endCol0:tok5", |
| 481 |
|
PA.getValue(sq, "cursor").toString()); |
| 482 |
|
|
| 483 |
1 |
sq.sequenceChanged(); |
| 484 |
1 |
assertEquals(11, sq.findPosition(5)); |
| 485 |
1 |
cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 486 |
1 |
assertEquals(new SequenceCursor(sq, 11, 6, ++token), cursor); |
| 487 |
|
|
| 488 |
1 |
assertEquals("test:Pos11:Col6:startCol1:endCol6:tok6", |
| 489 |
|
PA.getValue(sq, "cursor").toString()); |
| 490 |
|
|
| 491 |
1 |
sq.sequenceChanged(); |
| 492 |
|
|
| 493 |
1 |
assertEquals(12, sq.findPosition(6)); |
| 494 |
|
|
| 495 |
1 |
sq.sequenceChanged(); |
| 496 |
1 |
assertEquals(12, sq.findPosition(7)); |
| 497 |
|
|
| 498 |
|
|
| 499 |
|
|
| 500 |
|
|
| 501 |
1 |
sq = new Sequence("test/8-13", "--AB-C-DEF--"); |
| 502 |
1 |
assertEquals(8, sq.findPosition(0)); |
| 503 |
1 |
assertNull(PA.getValue(sq, "cursor")); |
| 504 |
1 |
assertEquals(1, PA.getValue(sq, "changeCount")); |
| 505 |
|
|
| 506 |
1 |
sq.sequenceChanged(); |
| 507 |
1 |
assertEquals(8, sq.findPosition(1)); |
| 508 |
1 |
assertNull(PA.getValue(sq, "cursor")); |
| 509 |
|
|
| 510 |
1 |
sq.sequenceChanged(); |
| 511 |
1 |
assertEquals(8, sq.findPosition(2)); |
| 512 |
1 |
assertEquals("test:Pos8:Col3:startCol3:endCol0:tok3", |
| 513 |
|
PA.getValue(sq, "cursor").toString()); |
| 514 |
|
|
| 515 |
1 |
sq.sequenceChanged(); |
| 516 |
1 |
assertEquals(9, sq.findPosition(3)); |
| 517 |
1 |
assertEquals("test:Pos9:Col4:startCol3:endCol0:tok4", |
| 518 |
|
PA.getValue(sq, "cursor").toString()); |
| 519 |
|
|
| 520 |
1 |
sq.sequenceChanged(); |
| 521 |
|
|
| 522 |
|
|
| 523 |
1 |
assertEquals(10, sq.findPosition(4)); |
| 524 |
1 |
assertEquals("test:Pos9:Col4:startCol3:endCol0:tok5", |
| 525 |
|
PA.getValue(sq, "cursor").toString()); |
| 526 |
|
|
| 527 |
1 |
sq.sequenceChanged(); |
| 528 |
1 |
assertEquals(10, sq.findPosition(5)); |
| 529 |
1 |
assertEquals("test:Pos10:Col6:startCol3:endCol0:tok6", |
| 530 |
|
PA.getValue(sq, "cursor").toString()); |
| 531 |
|
|
| 532 |
1 |
sq.sequenceChanged(); |
| 533 |
|
|
| 534 |
|
|
| 535 |
1 |
assertEquals(11, sq.findPosition(6)); |
| 536 |
1 |
assertEquals("test:Pos10:Col6:startCol3:endCol0:tok7", |
| 537 |
|
PA.getValue(sq, "cursor").toString()); |
| 538 |
|
|
| 539 |
1 |
sq.sequenceChanged(); |
| 540 |
1 |
assertEquals(11, sq.findPosition(7)); |
| 541 |
1 |
assertEquals("test:Pos11:Col8:startCol3:endCol0:tok8", |
| 542 |
|
PA.getValue(sq, "cursor").toString()); |
| 543 |
|
|
| 544 |
1 |
sq.sequenceChanged(); |
| 545 |
1 |
assertEquals(12, sq.findPosition(8)); |
| 546 |
1 |
assertEquals("test:Pos12:Col9:startCol3:endCol0:tok9", |
| 547 |
|
PA.getValue(sq, "cursor").toString()); |
| 548 |
|
|
| 549 |
|
|
| 550 |
|
|
| 551 |
|
|
| 552 |
1 |
sq.sequenceChanged(); |
| 553 |
1 |
assertEquals(13, sq.findPosition(9)); |
| 554 |
1 |
assertEquals("test:Pos13:Col10:startCol3:endCol10:tok10", |
| 555 |
|
PA.getValue(sq, "cursor").toString()); |
| 556 |
|
|
| 557 |
1 |
sq.sequenceChanged(); |
| 558 |
1 |
assertEquals(14, sq.findPosition(10)); |
| 559 |
1 |
assertEquals("test:Pos13:Col10:startCol3:endCol10:tok11", |
| 560 |
|
PA.getValue(sq, "cursor").toString()); |
| 561 |
|
|
| 562 |
|
|
| 563 |
|
|
| 564 |
|
|
| 565 |
|
|
| 566 |
1 |
sq.sequenceChanged(); |
| 567 |
1 |
assertEquals(14, sq.findPosition(11)); |
| 568 |
1 |
assertEquals("test:Pos13:Col10:startCol3:endCol10:tok12", |
| 569 |
|
PA.getValue(sq, "cursor").toString()); |
| 570 |
|
|
| 571 |
1 |
sq.sequenceChanged(); |
| 572 |
1 |
assertEquals(14, sq.findPosition(99)); |
| 573 |
1 |
assertEquals("test:Pos13:Col10:startCol3:endCol10:tok13", |
| 574 |
|
PA.getValue(sq, "cursor").toString()); |
| 575 |
|
|
| 576 |
|
|
| 577 |
|
|
| 578 |
|
|
| 579 |
1 |
sq = new Sequence("test/8-13", "--AB-C-DEF"); |
| 580 |
1 |
assertEquals(13, sq.findPosition(9)); |
| 581 |
1 |
assertEquals("test:Pos13:Col10:startCol3:endCol10:tok1", |
| 582 |
|
PA.getValue(sq, "cursor").toString()); |
| 583 |
1 |
sq.sequenceChanged(); |
| 584 |
1 |
assertEquals(12, sq.findPosition(8)); |
| 585 |
|
|
| 586 |
1 |
cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 587 |
1 |
assertEquals("test:Pos12:Col9:startCol3:endCol0:tok2", |
| 588 |
|
cursor.toString()); |
| 589 |
|
|
| 590 |
1 |
assertEquals(13, ((Sequence) sq).findPosition(10, cursor)); |
| 591 |
1 |
assertEquals(13, sq.findPosition(9)); |
| 592 |
|
|
| 593 |
1 |
assertEquals("test:Pos13:Col10:startCol3:endCol10:tok2", |
| 594 |
|
PA.getValue(sq, "cursor").toString()); |
| 595 |
|
} |
| 596 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (37) |
Complexity: 1 |
Complexity Density: 0.03 |
1PASS
|
|
| 597 |
1 |
@Test(groups = { "Functional" })... |
| 598 |
|
public void testDeleteChars() |
| 599 |
|
{ |
| 600 |
|
|
| 601 |
|
|
| 602 |
|
|
| 603 |
1 |
SequenceI sq = new Sequence("test", "ABCDEF"); |
| 604 |
1 |
assertNull(PA.getValue(sq, "datasetSequence")); |
| 605 |
1 |
assertEquals(1, sq.getStart()); |
| 606 |
1 |
assertEquals(6, sq.getEnd()); |
| 607 |
1 |
sq.deleteChars(2, 3); |
| 608 |
1 |
assertEquals("ABDEF", sq.getSequenceAsString()); |
| 609 |
1 |
assertEquals(1, sq.getStart()); |
| 610 |
1 |
assertEquals(5, sq.getEnd()); |
| 611 |
1 |
assertNull(PA.getValue(sq, "datasetSequence")); |
| 612 |
|
|
| 613 |
|
|
| 614 |
|
|
| 615 |
|
|
| 616 |
1 |
sq = new Sequence("test", "ABCDEF"); |
| 617 |
1 |
sq.deleteChars(0, 2); |
| 618 |
1 |
assertEquals("CDEF", sq.getSequenceAsString()); |
| 619 |
1 |
assertEquals(3, sq.getStart()); |
| 620 |
1 |
assertEquals(6, sq.getEnd()); |
| 621 |
1 |
assertNull(PA.getValue(sq, "datasetSequence")); |
| 622 |
|
|
| 623 |
1 |
sq = new Sequence("test", "ABCDE"); |
| 624 |
1 |
sq.deleteChars(0, 3); |
| 625 |
1 |
assertEquals("DE", sq.getSequenceAsString()); |
| 626 |
1 |
assertEquals(4, sq.getStart()); |
| 627 |
1 |
assertEquals(5, sq.getEnd()); |
| 628 |
1 |
assertNull(PA.getValue(sq, "datasetSequence")); |
| 629 |
|
|
| 630 |
|
|
| 631 |
|
|
| 632 |
|
|
| 633 |
1 |
sq = new Sequence("test", "ABCDEF"); |
| 634 |
1 |
sq.deleteChars(4, 6); |
| 635 |
1 |
assertEquals("ABCD", sq.getSequenceAsString()); |
| 636 |
1 |
assertEquals(1, sq.getStart()); |
| 637 |
1 |
assertEquals(4, sq.getEnd()); |
| 638 |
1 |
assertNull(PA.getValue(sq, "datasetSequence")); |
| 639 |
|
|
| 640 |
|
|
| 641 |
|
|
| 642 |
|
|
| 643 |
1 |
sq = new Sequence("test/8-11", "ABCD"); |
| 644 |
1 |
sq.deleteChars(0, 99); |
| 645 |
1 |
assertEquals("", sq.getSequenceAsString()); |
| 646 |
1 |
assertEquals(12, sq.getStart()); |
| 647 |
1 |
assertEquals(11, sq.getEnd()); |
| 648 |
|
|
| 649 |
1 |
sq = new Sequence("test/8-11", "----"); |
| 650 |
1 |
sq.deleteChars(0, 99); |
| 651 |
1 |
assertEquals("", sq.getSequenceAsString()); |
| 652 |
1 |
assertEquals(8, sq.getStart()); |
| 653 |
1 |
assertEquals(11, sq.getEnd()); |
| 654 |
|
} |
| 655 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (65) |
Complexity: 1 |
Complexity Density: 0.02 |
1PASS
|
|
| 656 |
1 |
@Test(groups = { "Functional" })... |
| 657 |
|
public void testDeleteChars_withDbRefsAndFeatures() |
| 658 |
|
{ |
| 659 |
|
|
| 660 |
|
|
| 661 |
|
|
| 662 |
|
|
| 663 |
1 |
SequenceI sq = new Sequence("test", "ABCDEF"); |
| 664 |
1 |
sq.createDatasetSequence(); |
| 665 |
1 |
DBRefEntry dbr1 = new DBRefEntry("Uniprot", "0", "a123"); |
| 666 |
1 |
sq.addDBRef(dbr1); |
| 667 |
1 |
Object ds = PA.getValue(sq, "datasetSequence"); |
| 668 |
1 |
assertNotNull(ds); |
| 669 |
1 |
assertEquals(1, sq.getStart()); |
| 670 |
1 |
assertEquals(6, sq.getEnd()); |
| 671 |
1 |
sq.deleteChars(2, 3); |
| 672 |
1 |
assertEquals("ABDEF", sq.getSequenceAsString()); |
| 673 |
1 |
assertEquals(1, sq.getStart()); |
| 674 |
1 |
assertEquals(5, sq.getEnd()); |
| 675 |
1 |
Object newDs = PA.getValue(sq, "datasetSequence"); |
| 676 |
1 |
assertNotNull(newDs); |
| 677 |
1 |
assertNotSame(ds, newDs); |
| 678 |
1 |
assertNotNull(sq.getDBRefs()); |
| 679 |
1 |
assertEquals(1, sq.getDBRefs().size()); |
| 680 |
1 |
assertNotSame(dbr1, sq.getDBRefs().get(0)); |
| 681 |
1 |
assertEquals(dbr1, sq.getDBRefs().get(0)); |
| 682 |
|
|
| 683 |
|
|
| 684 |
|
|
| 685 |
|
|
| 686 |
|
|
| 687 |
1 |
sq = new Sequence("test", "ABCDEF"); |
| 688 |
1 |
sq.createDatasetSequence(); |
| 689 |
1 |
SequenceFeature sf1 = new SequenceFeature("Cath", "desc", 2, 4, 2f, |
| 690 |
|
"CathGroup"); |
| 691 |
1 |
sq.addSequenceFeature(sf1); |
| 692 |
1 |
ds = PA.getValue(sq, "datasetSequence"); |
| 693 |
1 |
assertNotNull(ds); |
| 694 |
1 |
assertEquals(1, sq.getStart()); |
| 695 |
1 |
assertEquals(6, sq.getEnd()); |
| 696 |
1 |
sq.deleteChars(2, 4); |
| 697 |
1 |
assertEquals("ABEF", sq.getSequenceAsString()); |
| 698 |
1 |
assertEquals(1, sq.getStart()); |
| 699 |
1 |
assertEquals(4, sq.getEnd()); |
| 700 |
1 |
newDs = PA.getValue(sq, "datasetSequence"); |
| 701 |
1 |
assertNotNull(newDs); |
| 702 |
1 |
assertNotSame(ds, newDs); |
| 703 |
1 |
List<SequenceFeature> sfs = sq.getSequenceFeatures(); |
| 704 |
1 |
assertEquals(1, sfs.size()); |
| 705 |
1 |
assertNotSame(sf1, sfs.get(0)); |
| 706 |
1 |
assertEquals(sf1, sfs.get(0)); |
| 707 |
|
|
| 708 |
|
|
| 709 |
|
|
| 710 |
|
|
| 711 |
|
|
| 712 |
1 |
sq = new Sequence("test", "ABCDEF"); |
| 713 |
1 |
sq.createDatasetSequence(); |
| 714 |
1 |
ds = PA.getValue(sq, "datasetSequence"); |
| 715 |
1 |
sf1 = new SequenceFeature("Cath", "desc", 2, 4, 2f, "CathGroup"); |
| 716 |
1 |
sq.addSequenceFeature(sf1); |
| 717 |
1 |
sq.deleteChars(0, 2); |
| 718 |
1 |
assertEquals("CDEF", sq.getSequenceAsString()); |
| 719 |
1 |
assertEquals(3, sq.getStart()); |
| 720 |
1 |
assertEquals(6, sq.getEnd()); |
| 721 |
1 |
assertSame(ds, PA.getValue(sq, "datasetSequence")); |
| 722 |
1 |
sfs = sq.getSequenceFeatures(); |
| 723 |
1 |
assertNotNull(sfs); |
| 724 |
1 |
assertEquals(1, sfs.size()); |
| 725 |
1 |
assertSame(sf1, sfs.get(0)); |
| 726 |
|
|
| 727 |
|
|
| 728 |
|
|
| 729 |
|
|
| 730 |
|
|
| 731 |
1 |
sq = new Sequence("test", "ABCDEF"); |
| 732 |
1 |
sq.createDatasetSequence(); |
| 733 |
1 |
ds = PA.getValue(sq, "datasetSequence"); |
| 734 |
1 |
dbr1 = new DBRefEntry("Uniprot", "0", "a123"); |
| 735 |
1 |
sq.addDBRef(dbr1); |
| 736 |
1 |
sq.deleteChars(4, 6); |
| 737 |
1 |
assertEquals("ABCD", sq.getSequenceAsString()); |
| 738 |
1 |
assertEquals(1, sq.getStart()); |
| 739 |
1 |
assertEquals(4, sq.getEnd()); |
| 740 |
1 |
assertSame(ds, PA.getValue(sq, "datasetSequence")); |
| 741 |
1 |
assertNotNull(sq.getDBRefs()); |
| 742 |
1 |
assertEquals(1, sq.getDBRefs().size()); |
| 743 |
1 |
assertSame(dbr1, sq.getDBRefs().get(0)); |
| 744 |
|
} |
| 745 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (5) |
Complexity: 1 |
Complexity Density: 0.2 |
1PASS
|
|
| 746 |
1 |
@Test(groups = { "Functional" })... |
| 747 |
|
public void testInsertCharAt() |
| 748 |
|
{ |
| 749 |
|
|
| 750 |
1 |
SequenceI sq = new Sequence("test", "ABCDEF"); |
| 751 |
1 |
sq.insertCharAt(0, 'z'); |
| 752 |
1 |
assertEquals("zABCDEF", sq.getSequenceAsString()); |
| 753 |
1 |
sq.insertCharAt(2, 2, 'x'); |
| 754 |
1 |
assertEquals("zAxxBCDEF", sq.getSequenceAsString()); |
| 755 |
|
|
| 756 |
|
|
| 757 |
|
} |
| 758 |
|
|
| 759 |
|
|
| 760 |
|
|
| 761 |
|
|
| 762 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (3) |
Complexity: 1 |
Complexity Density: 0.33 |
1PASS
|
|
| 763 |
1 |
@Test(groups = { "Functional" })... |
| 764 |
|
public void testGapMap() |
| 765 |
|
{ |
| 766 |
1 |
SequenceI sq = new Sequence("test", "-A--B-CD-E--F-"); |
| 767 |
1 |
sq.createDatasetSequence(); |
| 768 |
1 |
assertEquals("[1, 4, 6, 7, 9, 12]", Arrays.toString(sq.gapMap())); |
| 769 |
|
} |
| 770 |
|
|
| 771 |
|
|
| 772 |
|
|
| 773 |
|
|
| 774 |
|
|
| |
|
| 95.2% |
Uncovered Elements: 1 (21) |
Complexity: 2 |
Complexity Density: 0.1 |
1PASS
|
|
| 775 |
1 |
@Test(groups = { "Functional" })... |
| 776 |
|
public void testGetSequenceFeatures() |
| 777 |
|
{ |
| 778 |
1 |
SequenceI sq = new Sequence("test", "GATCAT"); |
| 779 |
1 |
sq.createDatasetSequence(); |
| 780 |
|
|
| 781 |
1 |
assertTrue(sq.getSequenceFeatures().isEmpty()); |
| 782 |
|
|
| 783 |
|
|
| 784 |
|
|
| 785 |
|
|
| 786 |
1 |
SequenceFeature sf = new SequenceFeature("Cath", "desc", 2, 4, 2f, |
| 787 |
|
null); |
| 788 |
1 |
sq.addSequenceFeature(sf); |
| 789 |
1 |
List<SequenceFeature> sfs = sq.getSequenceFeatures(); |
| 790 |
1 |
assertEquals(1, sfs.size()); |
| 791 |
1 |
assertSame(sf, sfs.get(0)); |
| 792 |
|
|
| 793 |
|
|
| 794 |
|
|
| 795 |
|
|
| 796 |
|
|
| 797 |
|
|
| 798 |
|
|
| 799 |
|
|
| 800 |
1 |
SequenceFeature sf2 = new SequenceFeature("Cath", "desc", 2, 4, 2f, |
| 801 |
|
null); |
| 802 |
1 |
sq.getDatasetSequence().addSequenceFeature(sf2); |
| 803 |
1 |
sfs = sq.getSequenceFeatures(); |
| 804 |
1 |
assertEquals(1, sfs.size()); |
| 805 |
1 |
assertSame(sf, sfs.get(0)); |
| 806 |
|
|
| 807 |
|
|
| 808 |
|
|
| 809 |
|
|
| 810 |
|
|
| 811 |
1 |
sq.setSequenceFeatures(null); |
| 812 |
1 |
assertTrue(sq.getDatasetSequence().getSequenceFeatures().isEmpty()); |
| 813 |
|
|
| 814 |
|
|
| 815 |
|
|
| 816 |
|
|
| 817 |
|
|
| 818 |
1 |
sq.getDatasetSequence().setSequenceFeatures(null); |
| 819 |
|
|
| 820 |
|
|
| 821 |
|
|
| 822 |
|
|
| 823 |
1 |
try |
| 824 |
|
{ |
| 825 |
1 |
sq.getDatasetSequence().setDatasetSequence(sq); |
| 826 |
0 |
Assert.fail( |
| 827 |
|
"Expected Error to be raised when calling setDatasetSequence with self reference"); |
| 828 |
|
} catch (IllegalArgumentException e) |
| 829 |
|
{ |
| 830 |
|
|
| 831 |
1 |
assertTrue(e.getMessage().toLowerCase(Locale.ROOT) |
| 832 |
|
.contains("implementation error")); |
| 833 |
|
} |
| 834 |
1 |
assertTrue(sq.getSequenceFeatures().isEmpty()); |
| 835 |
|
} |
| 836 |
|
|
| 837 |
|
|
| 838 |
|
|
| 839 |
|
|
| 840 |
|
|
| 841 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (3) |
Complexity: 1 |
Complexity Density: 0.33 |
1PASS
|
|
| 842 |
1 |
@Test(groups = { "Functional" })... |
| 843 |
|
public void testFindPositionMap() |
| 844 |
|
{ |
| 845 |
|
|
| 846 |
|
|
| 847 |
|
|
| 848 |
|
|
| 849 |
|
|
| 850 |
|
|
| 851 |
1 |
Sequence sq = new Sequence("TestSeq", "AB.C-D E."); |
| 852 |
1 |
int[] map = sq.findPositionMap(); |
| 853 |
1 |
assertEquals(Arrays.toString(new int[] { 1, 2, 3, 3, 4, 4, 5, 5, 6 }), |
| 854 |
|
Arrays.toString(map)); |
| 855 |
|
} |
| 856 |
|
|
| 857 |
|
|
| 858 |
|
|
| 859 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (7) |
Complexity: 1 |
Complexity Density: 0.14 |
1PASS
|
|
| 860 |
1 |
@Test(groups = { "Functional" })... |
| 861 |
|
public void testGetSubsequence() |
| 862 |
|
{ |
| 863 |
1 |
SequenceI sq = new Sequence("TestSeq", "ABCDEFG"); |
| 864 |
1 |
sq.createDatasetSequence(); |
| 865 |
|
|
| 866 |
|
|
| 867 |
1 |
SequenceI subseq = sq.getSubSequence(2, 4); |
| 868 |
|
|
| 869 |
1 |
assertEquals("CD", subseq.getSequenceAsString()); |
| 870 |
|
|
| 871 |
1 |
assertEquals(3, subseq.getStart()); |
| 872 |
1 |
assertEquals(4, subseq.getEnd()); |
| 873 |
|
|
| 874 |
1 |
assertSame(sq.getDatasetSequence(), subseq.getDatasetSequence()); |
| 875 |
|
} |
| 876 |
|
|
| 877 |
|
|
| 878 |
|
|
| 879 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (14) |
Complexity: 1 |
Complexity Density: 0.07 |
1PASS
|
|
| 880 |
1 |
@Test(groups = { "Functional" })... |
| 881 |
|
public void testCreateDatasetSequence() |
| 882 |
|
{ |
| 883 |
1 |
SequenceI sq = new Sequence("my", "ASDASD"); |
| 884 |
1 |
sq.addSequenceFeature( |
| 885 |
|
new SequenceFeature("type", "desc", 1, 10, 1f, "group")); |
| 886 |
1 |
sq.addDBRef(new DBRefEntry("source", "version", "accession")); |
| 887 |
1 |
assertNull(sq.getDatasetSequence()); |
| 888 |
1 |
assertNotNull(PA.getValue(sq, "sequenceFeatureStore")); |
| 889 |
1 |
assertNotNull(PA.getValue(sq, "dbrefs")); |
| 890 |
|
|
| 891 |
1 |
SequenceI rds = sq.createDatasetSequence(); |
| 892 |
1 |
assertNotNull(rds); |
| 893 |
1 |
assertNull(rds.getDatasetSequence()); |
| 894 |
1 |
assertSame(sq.getDatasetSequence(), rds); |
| 895 |
|
|
| 896 |
|
|
| 897 |
1 |
assertNull(PA.getValue(sq, "sequenceFeatureStore")); |
| 898 |
1 |
assertNull(PA.getValue(sq, "dbrefs")); |
| 899 |
1 |
assertNotNull(PA.getValue(rds, "sequenceFeatureStore")); |
| 900 |
1 |
assertNotNull(PA.getValue(rds, "dbrefs")); |
| 901 |
|
} |
| 902 |
|
|
| 903 |
|
|
| 904 |
|
|
| 905 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (64) |
Complexity: 1 |
Complexity Density: 0.02 |
1PASS
|
|
| 906 |
1 |
@Test(groups = { "Functional" })... |
| 907 |
|
public void testDeriveSequence_existingDataset() |
| 908 |
|
{ |
| 909 |
1 |
Sequence sq = new Sequence("Seq1", "CD"); |
| 910 |
1 |
sq.setDatasetSequence(new Sequence("Seq1", "ABCDEF")); |
| 911 |
1 |
sq.getDatasetSequence().addSequenceFeature( |
| 912 |
|
new SequenceFeature("", "", 1, 2, 0f, null)); |
| 913 |
1 |
sq.setStart(3); |
| 914 |
1 |
sq.setEnd(4); |
| 915 |
|
|
| 916 |
1 |
sq.setDescription("Test sequence description.."); |
| 917 |
1 |
sq.setVamsasId("TestVamsasId"); |
| 918 |
1 |
sq.addDBRef(new DBRefEntry("PDB", "version0", "1TST")); |
| 919 |
|
|
| 920 |
1 |
sq.addDBRef(new DBRefEntry("PDB", "version1", "1PDB")); |
| 921 |
1 |
sq.addDBRef(new DBRefEntry("PDB", "version2", "2PDB")); |
| 922 |
1 |
sq.addDBRef(new DBRefEntry("PDB", "version3", "3PDB")); |
| 923 |
1 |
sq.addDBRef(new DBRefEntry("PDB", "version4", "4PDB")); |
| 924 |
|
|
| 925 |
1 |
sq.addPDBId(new PDBEntry("1PDB", "A", Type.PDB, "filePath/test1")); |
| 926 |
1 |
sq.addPDBId(new PDBEntry("1PDB", "B", Type.PDB, "filePath/test1")); |
| 927 |
1 |
sq.addPDBId(new PDBEntry("2PDB", "A", Type.MMCIF, "filePath/test2")); |
| 928 |
1 |
sq.addPDBId(new PDBEntry("2PDB", "B", Type.MMCIF, "filePath/test2")); |
| 929 |
|
|
| 930 |
|
|
| 931 |
1 |
DBRefEntry pdb1pdb = new DBRefEntry("PDB", "version1", "1PDB"); |
| 932 |
1 |
DBRefEntry pdb2pdb = new DBRefEntry("PDB", "version2", "2PDB"); |
| 933 |
|
|
| 934 |
1 |
List<DBRefEntry> primRefs = Arrays |
| 935 |
|
.asList(new DBRefEntry[] |
| 936 |
|
{ pdb1pdb, pdb2pdb }); |
| 937 |
|
|
| 938 |
1 |
sq.getDatasetSequence().addDBRef(pdb1pdb); |
| 939 |
1 |
sq.getDatasetSequence().addDBRef(pdb2pdb); |
| 940 |
1 |
sq.getDatasetSequence() |
| 941 |
|
.addDBRef(new DBRefEntry("PDB", "version3", "3PDB")); |
| 942 |
|
|
| 943 |
1 |
sq.getDatasetSequence() |
| 944 |
|
.addDBRef(new DBRefEntry("PDB", "version4", "4PDB")); |
| 945 |
|
|
| 946 |
|
|
| 947 |
1 |
PDBEntry pdbe1a = new PDBEntry("1PDB", "A", Type.PDB, "filePath/test1"); |
| 948 |
1 |
PDBEntry pdbe1b = new PDBEntry("1PDB", "B", Type.PDB, "filePath/test1"); |
| 949 |
1 |
PDBEntry pdbe2a = new PDBEntry("2PDB", "A", Type.MMCIF, |
| 950 |
|
"filePath/test2"); |
| 951 |
1 |
PDBEntry pdbe2b = new PDBEntry("2PDB", "B", Type.MMCIF, |
| 952 |
|
"filePath/test2"); |
| 953 |
1 |
sq.getDatasetSequence().addPDBId(pdbe1a); |
| 954 |
1 |
sq.getDatasetSequence().addPDBId(pdbe1b); |
| 955 |
1 |
sq.getDatasetSequence().addPDBId(pdbe2a); |
| 956 |
1 |
sq.getDatasetSequence().addPDBId(pdbe2b); |
| 957 |
|
|
| 958 |
|
|
| 959 |
|
|
| 960 |
|
|
| 961 |
1 |
Assert.assertEquals(sq.getDatasetSequence().getAllPDBEntries(), |
| 962 |
|
Arrays.asList(new PDBEntry[] |
| 963 |
|
{ pdbe1a, pdbe1b, pdbe2a, pdbe2b }), |
| 964 |
|
"PDB Entries were not found on dataset sequence."); |
| 965 |
|
|
| 966 |
|
|
| 967 |
|
|
| 968 |
|
|
| 969 |
1 |
Assert.assertEquals(pdbe1a, sq.getDatasetSequence().getPDBEntry("1PDB"), |
| 970 |
|
"PDB Entry '1PDB' not found on dataset sequence via getPDBEntry."); |
| 971 |
1 |
ArrayList<Annotation> annotsList = new ArrayList<>(); |
| 972 |
1 |
System.out.println(">>>>>> " + sq.getSequenceAsString().length()); |
| 973 |
1 |
annotsList.add(new Annotation("A", "A", 'X', 0.1f)); |
| 974 |
1 |
annotsList.add(new Annotation("A", "A", 'X', 0.1f)); |
| 975 |
1 |
Annotation[] annots = annotsList.toArray(new Annotation[0]); |
| 976 |
1 |
sq.addAlignmentAnnotation(new AlignmentAnnotation("Test annot", |
| 977 |
|
"Test annot description", annots)); |
| 978 |
1 |
sq.getDatasetSequence().addAlignmentAnnotation(new AlignmentAnnotation( |
| 979 |
|
"Test annot", "Test annot description", annots)); |
| 980 |
1 |
Assert.assertEquals(sq.getDescription(), "Test sequence description.."); |
| 981 |
1 |
Assert.assertEquals(sq.getDBRefs().size(), 5); |
| 982 |
|
|
| 983 |
1 |
Assert.assertEquals(sq.getAllPDBEntries().size(), 4); |
| 984 |
1 |
Assert.assertNotNull(sq.getAnnotation()); |
| 985 |
1 |
Assert.assertEquals(sq.getAnnotation()[0].annotations.length, 2); |
| 986 |
1 |
Assert.assertEquals(sq.getDatasetSequence().getDBRefs().size(), 5); |
| 987 |
|
|
| 988 |
|
|
| 989 |
1 |
Assert.assertEquals(sq.getDatasetSequence().getAllPDBEntries().size(), |
| 990 |
|
4); |
| 991 |
1 |
Assert.assertNotNull(sq.getDatasetSequence().getAnnotation()); |
| 992 |
|
|
| 993 |
1 |
Sequence derived = (Sequence) sq.deriveSequence(); |
| 994 |
|
|
| 995 |
1 |
Assert.assertEquals(derived.getDescription(), |
| 996 |
|
"Test sequence description.."); |
| 997 |
1 |
Assert.assertEquals(derived.getDBRefs().size(), 5); |
| 998 |
1 |
Assert.assertEquals(derived.getAllPDBEntries().size(), 4); |
| 999 |
1 |
Assert.assertNotNull(derived.getAnnotation()); |
| 1000 |
1 |
Assert.assertEquals(derived.getAnnotation()[0].annotations.length, 2); |
| 1001 |
1 |
Assert.assertEquals(derived.getDatasetSequence().getDBRefs().size(), 5); |
| 1002 |
1 |
Assert.assertEquals( |
| 1003 |
|
derived.getDatasetSequence().getAllPDBEntries().size(), 4); |
| 1004 |
1 |
Assert.assertNotNull(derived.getDatasetSequence().getAnnotation()); |
| 1005 |
|
|
| 1006 |
1 |
assertEquals("CD", derived.getSequenceAsString()); |
| 1007 |
1 |
assertSame(sq.getDatasetSequence(), derived.getDatasetSequence()); |
| 1008 |
|
|
| 1009 |
|
|
| 1010 |
1 |
assertNotNull(sq.getSequenceFeatures()); |
| 1011 |
1 |
assertEquals(sq.getSequenceFeatures(), derived.getSequenceFeatures()); |
| 1012 |
|
|
| 1013 |
|
|
| 1014 |
|
|
| 1015 |
|
|
| 1016 |
|
|
| 1017 |
|
|
| 1018 |
1 |
assertEquals(primRefs, sq.getPrimaryDBRefs()); |
| 1019 |
1 |
assertEquals(primRefs, sq.getDatasetSequence().getPrimaryDBRefs()); |
| 1020 |
|
|
| 1021 |
1 |
assertEquals(sq.getPrimaryDBRefs(), derived.getPrimaryDBRefs()); |
| 1022 |
|
|
| 1023 |
|
} |
| 1024 |
|
|
| 1025 |
|
|
| 1026 |
|
|
| 1027 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (6) |
Complexity: 1 |
Complexity Density: 0.17 |
1PASS
|
|
| 1028 |
1 |
@Test(groups = { "Functional" })... |
| 1029 |
|
public void testDeriveSequence_noDatasetUngapped() |
| 1030 |
|
{ |
| 1031 |
1 |
SequenceI sq = new Sequence("Seq1", "ABCDEF"); |
| 1032 |
1 |
assertEquals(1, sq.getStart()); |
| 1033 |
1 |
assertEquals(6, sq.getEnd()); |
| 1034 |
1 |
SequenceI derived = sq.deriveSequence(); |
| 1035 |
1 |
assertEquals("ABCDEF", derived.getSequenceAsString()); |
| 1036 |
1 |
assertEquals("ABCDEF", |
| 1037 |
|
derived.getDatasetSequence().getSequenceAsString()); |
| 1038 |
|
} |
| 1039 |
|
|
| 1040 |
|
|
| 1041 |
|
|
| 1042 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (7) |
Complexity: 1 |
Complexity Density: 0.14 |
1PASS
|
|
| 1043 |
1 |
@Test(groups = { "Functional" })... |
| 1044 |
|
public void testDeriveSequence_noDatasetGapped() |
| 1045 |
|
{ |
| 1046 |
1 |
SequenceI sq = new Sequence("Seq1", "AB-C.D EF"); |
| 1047 |
1 |
assertEquals(1, sq.getStart()); |
| 1048 |
1 |
assertEquals(6, sq.getEnd()); |
| 1049 |
1 |
assertNull(sq.getDatasetSequence()); |
| 1050 |
1 |
SequenceI derived = sq.deriveSequence(); |
| 1051 |
1 |
assertEquals("AB-C.D EF", derived.getSequenceAsString()); |
| 1052 |
1 |
assertEquals("ABCDEF", |
| 1053 |
|
derived.getDatasetSequence().getSequenceAsString()); |
| 1054 |
|
} |
| 1055 |
|
|
| 1056 |
|
|
| 1057 |
|
|
| 1058 |
|
|
| 1059 |
|
|
| 1060 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (15) |
Complexity: 1 |
Complexity Density: 0.07 |
1PASS
|
|
| 1061 |
1 |
@Test(groups = { "Functional" })... |
| 1062 |
|
public void testCopyPasteStyleDerivesequence_withcontactMatrixAnn() |
| 1063 |
|
{ |
| 1064 |
1 |
SequenceI seq1 = new Sequence("seq1", "ACDACDACD"); |
| 1065 |
1 |
seq1.createDatasetSequence(); |
| 1066 |
1 |
ContactMatrixI cm = new SeqDistanceContactMatrix(seq1.getLength()); |
| 1067 |
|
|
| 1068 |
|
|
| 1069 |
1 |
AlignmentAnnotation aann = seq1.addContactList(cm); |
| 1070 |
1 |
assertTrue(aann.sequenceRef == seq1); |
| 1071 |
1 |
assertEquals(1, seq1.getAnnotation().length); |
| 1072 |
1 |
assertNotNull(seq1.getContactListFor(seq1.getAnnotation()[0], 1)); |
| 1073 |
|
|
| 1074 |
1 |
SequenceI seq_derived = seq1.deriveSequence(); |
| 1075 |
1 |
assertEquals(1, seq_derived.getAnnotation().length); |
| 1076 |
1 |
assertTrue(cm == seq_derived |
| 1077 |
|
.getContactMatrixFor(seq_derived.getAnnotation()[0])); |
| 1078 |
1 |
assertNotNull(seq_derived |
| 1079 |
|
.getContactListFor(seq_derived.getAnnotation()[0], 1)); |
| 1080 |
|
|
| 1081 |
|
|
| 1082 |
|
|
| 1083 |
1 |
SequenceI seq_copied = new Sequence((Sequence) seq_derived); |
| 1084 |
1 |
assertEquals(1, seq_copied.getAnnotation().length); |
| 1085 |
1 |
assertTrue(cm == seq_copied |
| 1086 |
|
.getContactMatrixFor(seq_copied.getAnnotation()[0])); |
| 1087 |
1 |
assertNotNull( |
| 1088 |
|
seq_copied.getContactListFor(seq_copied.getAnnotation()[0], 1)); |
| 1089 |
|
|
| 1090 |
|
} |
| 1091 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (13) |
Complexity: 1 |
Complexity Density: 0.08 |
1PASS
|
|
| 1092 |
1 |
@Test(groups = { "Functional" })... |
| 1093 |
|
public void testCopyConstructor_noDataset() |
| 1094 |
|
{ |
| 1095 |
1 |
SequenceI seq1 = new Sequence("Seq1", "AB-C.D EF"); |
| 1096 |
1 |
seq1.setDescription("description"); |
| 1097 |
1 |
seq1.addAlignmentAnnotation( |
| 1098 |
|
new AlignmentAnnotation("label", "desc", 1.3d)); |
| 1099 |
1 |
seq1.addSequenceFeature( |
| 1100 |
|
new SequenceFeature("type", "desc", 22, 33, 12.4f, "group")); |
| 1101 |
1 |
seq1.addPDBId(new PDBEntry("1A70", "B", Type.PDB, "File")); |
| 1102 |
1 |
seq1.addDBRef(new DBRefEntry("EMBL", "1.2", "AZ12345")); |
| 1103 |
|
|
| 1104 |
1 |
SequenceI copy = new Sequence(seq1); |
| 1105 |
|
|
| 1106 |
1 |
assertNull(copy.getDatasetSequence()); |
| 1107 |
|
|
| 1108 |
1 |
verifyCopiedSequence(seq1, copy); |
| 1109 |
|
|
| 1110 |
|
|
| 1111 |
|
|
| 1112 |
|
|
| 1113 |
|
|
| 1114 |
|
|
| 1115 |
|
|
| 1116 |
1 |
List<DBRefEntry> dbrefs = copy.getDBRefs(); |
| 1117 |
1 |
assertEquals(1, dbrefs.size()); |
| 1118 |
1 |
assertFalse(dbrefs.get(0) == seq1.getDBRefs().get(0)); |
| 1119 |
1 |
assertTrue(dbrefs.get(0).equals(seq1.getDBRefs().get(0))); |
| 1120 |
|
} |
| 1121 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (14) |
Complexity: 1 |
Complexity Density: 0.07 |
1PASS
|
|
| 1122 |
1 |
@Test(groups = { "Functional" })... |
| 1123 |
|
public void testCopyConstructor_withDataset() |
| 1124 |
|
{ |
| 1125 |
1 |
SequenceI seq1 = new Sequence("Seq1", "AB-C.D EF"); |
| 1126 |
1 |
seq1.createDatasetSequence(); |
| 1127 |
1 |
seq1.setDescription("description"); |
| 1128 |
1 |
seq1.addAlignmentAnnotation( |
| 1129 |
|
new AlignmentAnnotation("label", "desc", 1.3d)); |
| 1130 |
|
|
| 1131 |
|
|
| 1132 |
1 |
seq1.addSequenceFeature( |
| 1133 |
|
new SequenceFeature("type", "desc", 22, 33, 12.4f, "group")); |
| 1134 |
1 |
seq1.addPDBId(new PDBEntry("1A70", "B", Type.PDB, "File")); |
| 1135 |
|
|
| 1136 |
1 |
seq1.getDatasetSequence() |
| 1137 |
|
.addDBRef(new DBRefEntry("EMBL", "1.2", "AZ12345")); |
| 1138 |
|
|
| 1139 |
1 |
SequenceI copy = new Sequence(seq1); |
| 1140 |
|
|
| 1141 |
1 |
assertNotNull(copy.getDatasetSequence()); |
| 1142 |
1 |
assertSame(copy.getDatasetSequence(), seq1.getDatasetSequence()); |
| 1143 |
|
|
| 1144 |
1 |
verifyCopiedSequence(seq1, copy); |
| 1145 |
|
|
| 1146 |
|
|
| 1147 |
|
|
| 1148 |
1 |
List<DBRefEntry> dbrefs = copy.getDBRefs(); |
| 1149 |
1 |
assertEquals(1, dbrefs.size()); |
| 1150 |
1 |
assertSame(dbrefs.get(0), seq1.getDBRefs().get(0)); |
| 1151 |
|
} |
| 1152 |
|
|
| 1153 |
|
|
| 1154 |
|
|
| 1155 |
|
|
| 1156 |
|
@param |
| 1157 |
|
@param |
| 1158 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (23) |
Complexity: 3 |
Complexity Density: 0.14 |
|
| 1159 |
2 |
protected void verifyCopiedSequence(SequenceI seq1, SequenceI copy)... |
| 1160 |
|
{ |
| 1161 |
|
|
| 1162 |
2 |
assertEquals(copy.getName(), seq1.getName()); |
| 1163 |
2 |
assertEquals(copy.getDescription(), seq1.getDescription()); |
| 1164 |
2 |
assertEquals(copy.getStart(), seq1.getStart()); |
| 1165 |
2 |
assertEquals(copy.getEnd(), seq1.getEnd()); |
| 1166 |
2 |
assertEquals(copy.getSequenceAsString(), seq1.getSequenceAsString()); |
| 1167 |
|
|
| 1168 |
|
|
| 1169 |
2 |
AlignmentAnnotation[] anns = copy.getAnnotation(); |
| 1170 |
2 |
assertEquals(1, anns.length); |
| 1171 |
2 |
assertFalse(anns[0] == seq1.getAnnotation()[0]); |
| 1172 |
2 |
assertEquals(anns[0].label, seq1.getAnnotation()[0].label); |
| 1173 |
2 |
assertEquals(anns[0].description, seq1.getAnnotation()[0].description); |
| 1174 |
2 |
assertEquals(anns[0].score, seq1.getAnnotation()[0].score); |
| 1175 |
|
|
| 1176 |
|
|
| 1177 |
2 |
List<SequenceFeature> sfs = copy.getSequenceFeatures(); |
| 1178 |
2 |
assertEquals(1, sfs.size()); |
| 1179 |
2 |
if (seq1.getDatasetSequence() != null |
| 1180 |
|
&& copy.getDatasetSequence() == seq1.getDatasetSequence()) |
| 1181 |
|
{ |
| 1182 |
1 |
assertSame(sfs.get(0), seq1.getSequenceFeatures().get(0)); |
| 1183 |
|
} |
| 1184 |
|
else |
| 1185 |
|
{ |
| 1186 |
1 |
assertNotSame(sfs.get(0), seq1.getSequenceFeatures().get(0)); |
| 1187 |
|
} |
| 1188 |
2 |
assertEquals(sfs.get(0), seq1.getSequenceFeatures().get(0)); |
| 1189 |
|
|
| 1190 |
|
|
| 1191 |
2 |
Vector<PDBEntry> pdbs = copy.getAllPDBEntries(); |
| 1192 |
2 |
assertEquals(1, pdbs.size()); |
| 1193 |
2 |
assertFalse(pdbs.get(0) == seq1.getAllPDBEntries().get(0)); |
| 1194 |
2 |
assertTrue(pdbs.get(0).equals(seq1.getAllPDBEntries().get(0))); |
| 1195 |
|
} |
| 1196 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (5) |
Complexity: 1 |
Complexity Density: 0.2 |
1PASS
|
|
| 1197 |
1 |
@Test(groups = "Functional")... |
| 1198 |
|
public void testGetCharAt() |
| 1199 |
|
{ |
| 1200 |
1 |
SequenceI sq = new Sequence("", "abcde"); |
| 1201 |
1 |
assertEquals('a', sq.getCharAt(0)); |
| 1202 |
1 |
assertEquals('e', sq.getCharAt(4)); |
| 1203 |
1 |
assertEquals(' ', sq.getCharAt(5)); |
| 1204 |
1 |
assertEquals(' ', sq.getCharAt(-1)); |
| 1205 |
|
} |
| 1206 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (12) |
Complexity: 1 |
Complexity Density: 0.08 |
1PASS
|
|
| 1207 |
1 |
@Test(groups = { "Functional" })... |
| 1208 |
|
public void testAddSequenceFeatures() |
| 1209 |
|
{ |
| 1210 |
1 |
SequenceI sq = new Sequence("", "abcde"); |
| 1211 |
|
|
| 1212 |
1 |
assertFalse(sq.addSequenceFeature( |
| 1213 |
|
new SequenceFeature(null, "desc", 4, 8, 0f, null))); |
| 1214 |
1 |
assertTrue(sq.addSequenceFeature( |
| 1215 |
|
new SequenceFeature("Cath", "desc", 4, 8, 0f, null))); |
| 1216 |
|
|
| 1217 |
1 |
assertFalse(sq.addSequenceFeature( |
| 1218 |
|
new SequenceFeature("Cath", "desc", 4, 8, 0f, null))); |
| 1219 |
|
|
| 1220 |
1 |
assertTrue(sq.addSequenceFeature( |
| 1221 |
|
new SequenceFeature("Scop", "desc", 4, 8, 0f, null))); |
| 1222 |
|
|
| 1223 |
1 |
assertTrue(sq.addSequenceFeature( |
| 1224 |
|
new SequenceFeature("Cath", "description", 4, 8, 0f, null))); |
| 1225 |
|
|
| 1226 |
1 |
assertTrue(sq.addSequenceFeature( |
| 1227 |
|
new SequenceFeature("Cath", "desc", 3, 8, 0f, null))); |
| 1228 |
|
|
| 1229 |
|
|
| 1230 |
1 |
assertTrue(sq.addSequenceFeature( |
| 1231 |
|
new SequenceFeature("Cath", "desc", 4, 9, 0f, null))); |
| 1232 |
|
|
| 1233 |
|
|
| 1234 |
1 |
assertTrue(sq.addSequenceFeature( |
| 1235 |
|
new SequenceFeature("Cath", "desc", 4, 8, 1f, null))); |
| 1236 |
|
|
| 1237 |
1 |
assertTrue(sq.addSequenceFeature( |
| 1238 |
|
new SequenceFeature("Cath", "desc", 4, 8, Float.NaN, null))); |
| 1239 |
|
|
| 1240 |
1 |
assertTrue(sq.addSequenceFeature( |
| 1241 |
|
new SequenceFeature("Cath", "desc", 4, 8, 0f, "Metal"))); |
| 1242 |
|
|
| 1243 |
1 |
assertEquals(8, sq.getFeatures().getAllFeatures().size()); |
| 1244 |
|
} |
| 1245 |
|
|
| 1246 |
|
|
| 1247 |
|
|
| 1248 |
|
|
| 1249 |
|
@see |
| 1250 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (40) |
Complexity: 1 |
Complexity Density: 0.03 |
1PASS
|
|
| 1251 |
1 |
@Test(groups = { "Functional" })... |
| 1252 |
|
public void testAddDBRef() |
| 1253 |
|
{ |
| 1254 |
1 |
SequenceI sq = new Sequence("", "abcde"); |
| 1255 |
1 |
assertNull(sq.getDBRefs()); |
| 1256 |
1 |
DBRefEntry dbref = new DBRefEntry("Uniprot", "1", "P00340"); |
| 1257 |
1 |
sq.addDBRef(dbref); |
| 1258 |
1 |
assertEquals(1, sq.getDBRefs().size()); |
| 1259 |
1 |
assertSame(dbref, sq.getDBRefs().get(0)); |
| 1260 |
|
|
| 1261 |
|
|
| 1262 |
|
|
| 1263 |
|
|
| 1264 |
1 |
DBRefEntry dbref2 = new DBRefEntry("Uniprot", "2", "P00340"); |
| 1265 |
1 |
sq.addDBRef(dbref2); |
| 1266 |
1 |
assertEquals(2, sq.getDBRefs().size()); |
| 1267 |
1 |
assertSame(dbref, sq.getDBRefs().get(0)); |
| 1268 |
1 |
assertSame(dbref2, sq.getDBRefs().get(1)); |
| 1269 |
|
|
| 1270 |
|
|
| 1271 |
|
|
| 1272 |
|
|
| 1273 |
1 |
sq.addDBRef(new DBRefEntry("UNIPROT", "1", "p00340")); |
| 1274 |
1 |
assertEquals(2, sq.getDBRefs().size()); |
| 1275 |
|
|
| 1276 |
|
|
| 1277 |
|
|
| 1278 |
|
|
| 1279 |
1 |
DBRefEntry dbref3 = new DBRefEntry("UniRef", "1", "p00340"); |
| 1280 |
1 |
sq.addDBRef(dbref3); |
| 1281 |
1 |
assertEquals(3, sq.getDBRefs().size()); |
| 1282 |
1 |
assertSame(dbref3, sq.getDBRefs().get(2)); |
| 1283 |
|
|
| 1284 |
|
|
| 1285 |
|
|
| 1286 |
|
|
| 1287 |
1 |
DBRefEntry dbref4 = new DBRefEntry("UniRef", "1", "p00341"); |
| 1288 |
1 |
sq.addDBRef(dbref4); |
| 1289 |
1 |
assertEquals(4, sq.getDBRefs().size()); |
| 1290 |
1 |
assertSame(dbref4, sq.getDBRefs().get(3)); |
| 1291 |
|
|
| 1292 |
|
|
| 1293 |
|
|
| 1294 |
|
|
| 1295 |
1 |
DBRefEntry dbref5 = new DBRefEntry("UniRef", "1", "p00341"); |
| 1296 |
1 |
Mapping map = new Mapping( |
| 1297 |
|
new MapList(new int[] |
| 1298 |
|
{ 1, 3 }, new int[] { 1, 1 }, 3, 1)); |
| 1299 |
1 |
dbref5.setMap(map); |
| 1300 |
1 |
sq.addDBRef(dbref5); |
| 1301 |
1 |
assertEquals(4, sq.getDBRefs().size()); |
| 1302 |
1 |
assertSame(dbref4, sq.getDBRefs().get(3)); |
| 1303 |
1 |
assertSame(map, dbref4.getMap()); |
| 1304 |
|
|
| 1305 |
|
|
| 1306 |
|
|
| 1307 |
|
|
| 1308 |
1 |
dbref2.setVersion("0"); |
| 1309 |
1 |
DBRefEntry dbref6 = new DBRefEntry(dbref2.getSource(), "3", |
| 1310 |
|
dbref2.getAccessionId()); |
| 1311 |
1 |
sq.addDBRef(dbref6); |
| 1312 |
1 |
assertEquals(4, sq.getDBRefs().size()); |
| 1313 |
1 |
assertSame(dbref2, sq.getDBRefs().get(1)); |
| 1314 |
1 |
assertEquals("3", dbref2.getVersion()); |
| 1315 |
|
|
| 1316 |
|
|
| 1317 |
|
|
| 1318 |
|
|
| 1319 |
1 |
dbref3.setVersion("Uniprot:0"); |
| 1320 |
1 |
DBRefEntry dbref7 = new DBRefEntry(dbref3.getSource(), "3", |
| 1321 |
|
dbref3.getAccessionId()); |
| 1322 |
1 |
sq.addDBRef(dbref7); |
| 1323 |
1 |
assertEquals(4, sq.getDBRefs().size()); |
| 1324 |
1 |
assertSame(dbref3, sq.getDBRefs().get(2)); |
| 1325 |
1 |
assertEquals("3", dbref2.getVersion()); |
| 1326 |
|
} |
| 1327 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (37) |
Complexity: 1 |
Complexity Density: 0.03 |
1PASS
|
|
| 1328 |
1 |
@Test(groups = { "Functional" })... |
| 1329 |
|
public void testGetPrimaryDBRefs_peptide() |
| 1330 |
|
{ |
| 1331 |
1 |
SequenceI sq = new Sequence("aseq", "ASDFKYLMQPRST", 10, 22); |
| 1332 |
|
|
| 1333 |
|
|
| 1334 |
1 |
List<DBRefEntry> primaryDBRefs = sq.getPrimaryDBRefs(); |
| 1335 |
1 |
assertTrue(primaryDBRefs.isEmpty()); |
| 1336 |
|
|
| 1337 |
|
|
| 1338 |
1 |
sq.setDBRefs(null); |
| 1339 |
1 |
primaryDBRefs = sq.getPrimaryDBRefs(); |
| 1340 |
1 |
assertTrue(primaryDBRefs.isEmpty()); |
| 1341 |
|
|
| 1342 |
|
|
| 1343 |
1 |
DBRefEntry upentry1 = new DBRefEntry("UNIPROT", "0", "Q04760"); |
| 1344 |
1 |
sq.addDBRef(upentry1); |
| 1345 |
|
|
| 1346 |
|
|
| 1347 |
1 |
DBRefEntry upentry2 = new DBRefEntry("UNIPROT", "0", "Q04762"); |
| 1348 |
1 |
upentry2.setMap( |
| 1349 |
|
new Mapping(null, new MapList(new int[] |
| 1350 |
|
{ 10, 22 }, new int[] { 10, 22 }, 1, 1))); |
| 1351 |
1 |
sq.addDBRef(upentry2); |
| 1352 |
|
|
| 1353 |
|
|
| 1354 |
1 |
DBRefEntry upentry3 = new DBRefEntry("UNIPROT", "0", "Q04763"); |
| 1355 |
1 |
upentry3.setMap( |
| 1356 |
|
new Mapping(null, new MapList(new int[] |
| 1357 |
|
{ 8, 24 }, new int[] { 8, 24 }, 1, 1))); |
| 1358 |
1 |
sq.addDBRef(upentry3); |
| 1359 |
|
|
| 1360 |
|
|
| 1361 |
1 |
DBRefEntry upentry4 = new DBRefEntry("UNIPROT", "0", "Q04764"); |
| 1362 |
1 |
upentry4.setMap( |
| 1363 |
|
new Mapping(null, new MapList(new int[] |
| 1364 |
|
{ 10, 18 }, new int[] { 10, 18 }, 1, 1))); |
| 1365 |
1 |
sq.addDBRef(upentry4); |
| 1366 |
|
|
| 1367 |
|
|
| 1368 |
1 |
DBRefEntry upentry5 = new DBRefEntry("UNIPROT", "0", "Q04765"); |
| 1369 |
1 |
upentry5.setMap( |
| 1370 |
|
new Mapping(null, new MapList(new int[] |
| 1371 |
|
{ 12, 22 }, new int[] { 12, 22 }, 1, 1))); |
| 1372 |
1 |
sq.addDBRef(upentry5); |
| 1373 |
|
|
| 1374 |
|
|
| 1375 |
1 |
DBRefEntry upentry6 = new DBRefEntry("UNIPROT", "0", "Q04766"); |
| 1376 |
1 |
upentry6.setMap( |
| 1377 |
|
new Mapping(null, new MapList(new int[] |
| 1378 |
|
{ 12, 18 }, new int[] { 112, 118 }, 1, 1))); |
| 1379 |
1 |
sq.addDBRef(upentry6); |
| 1380 |
|
|
| 1381 |
|
|
| 1382 |
1 |
DBRefEntry upentry7 = new DBRefEntry("Pfam", "0", "PF00903"); |
| 1383 |
1 |
sq.addDBRef(upentry7); |
| 1384 |
|
|
| 1385 |
|
|
| 1386 |
1 |
DBRefEntry pdbentry = new DBRefEntry("PDB", "0", "1qip"); |
| 1387 |
1 |
sq.addDBRef(pdbentry); |
| 1388 |
|
|
| 1389 |
|
|
| 1390 |
1 |
sq.addDBRef(new DBRefEntry("PDB", "0", "1AAA")); |
| 1391 |
|
|
| 1392 |
|
|
| 1393 |
1 |
sq.addDBRef(new DBRefEntry("PDB", "0", "1DDD")); |
| 1394 |
|
|
| 1395 |
|
|
| 1396 |
|
|
| 1397 |
|
|
| 1398 |
1 |
sq.addPDBId(new PDBEntry("1QIP", null, Type.PDB, |
| 1399 |
|
new File("/blah").toString())); |
| 1400 |
|
|
| 1401 |
|
|
| 1402 |
1 |
sq.addPDBId(new PDBEntry("1AAA", null, null, null)); |
| 1403 |
|
|
| 1404 |
1 |
primaryDBRefs = sq.getPrimaryDBRefs(); |
| 1405 |
1 |
assertEquals(4, primaryDBRefs.size()); |
| 1406 |
1 |
assertTrue("Couldn't find simple primary reference (UNIPROT)", |
| 1407 |
|
primaryDBRefs.contains(upentry1)); |
| 1408 |
1 |
assertTrue("Couldn't find mapped primary reference (UNIPROT)", |
| 1409 |
|
primaryDBRefs.contains(upentry2)); |
| 1410 |
1 |
assertTrue("Couldn't find mapped context reference (UNIPROT)", |
| 1411 |
|
primaryDBRefs.contains(upentry3)); |
| 1412 |
1 |
assertTrue("Couldn't find expected PDB primary reference", |
| 1413 |
|
primaryDBRefs.contains(pdbentry)); |
| 1414 |
|
} |
| 1415 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (17) |
Complexity: 1 |
Complexity Density: 0.06 |
1PASS
|
|
| 1416 |
1 |
@Test(groups = { "Functional" })... |
| 1417 |
|
public void testGetPrimaryDBRefs_nucleotide() |
| 1418 |
|
{ |
| 1419 |
1 |
SequenceI sq = new Sequence("aseq", "TGATCACTCGACTAGCATCAGCATA", 10, |
| 1420 |
|
34); |
| 1421 |
|
|
| 1422 |
|
|
| 1423 |
1 |
DBRefEntry dbr1 = new DBRefEntry("ENSEMBL", "0", "ENSG1234"); |
| 1424 |
1 |
sq.addDBRef(dbr1); |
| 1425 |
|
|
| 1426 |
|
|
| 1427 |
1 |
DBRefEntry dbr2 = new DBRefEntry("ENSEMBL", "0", "ENST1234"); |
| 1428 |
1 |
dbr2.setMap( |
| 1429 |
|
new Mapping(null, new MapList(new int[] |
| 1430 |
|
{ 15, 25 }, new int[] { 1, 11 }, 1, 1))); |
| 1431 |
1 |
sq.addDBRef(dbr2); |
| 1432 |
|
|
| 1433 |
|
|
| 1434 |
1 |
DBRefEntry dbr3 = new DBRefEntry("EMBL", "0", "J1234"); |
| 1435 |
1 |
dbr3.setMap( |
| 1436 |
|
new Mapping(null, new MapList(new int[] |
| 1437 |
|
{ 10, 34 }, new int[] { 10, 34 }, 1, 1))); |
| 1438 |
1 |
sq.addDBRef(dbr3); |
| 1439 |
|
|
| 1440 |
|
|
| 1441 |
1 |
DBRefEntry dbr4 = new DBRefEntry("CCDS", "0", "J1234"); |
| 1442 |
1 |
sq.addDBRef(dbr4); |
| 1443 |
|
|
| 1444 |
|
|
| 1445 |
1 |
DBRefEntry dbr5 = new DBRefEntry("UNIPROT", "0", "Q87654"); |
| 1446 |
1 |
sq.addDBRef(dbr5); |
| 1447 |
|
|
| 1448 |
1 |
List<DBRefEntry> primaryDBRefs = sq.getPrimaryDBRefs(); |
| 1449 |
1 |
assertEquals(2, primaryDBRefs.size()); |
| 1450 |
1 |
assertTrue(primaryDBRefs.contains(dbr1)); |
| 1451 |
1 |
assertTrue(primaryDBRefs.contains(dbr3)); |
| 1452 |
|
} |
| 1453 |
|
|
| 1454 |
|
|
| 1455 |
|
|
| 1456 |
|
|
| 1457 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (17) |
Complexity: 1 |
Complexity Density: 0.06 |
1PASS
|
|
| 1458 |
1 |
@Test(groups = { "Functional" })... |
| 1459 |
|
public void testUpdatePDBIds() |
| 1460 |
|
{ |
| 1461 |
1 |
PDBEntry pdbe1 = new PDBEntry("3A6S", null, null, null); |
| 1462 |
1 |
seq.addPDBId(pdbe1); |
| 1463 |
1 |
seq.addDBRef(new DBRefEntry("Ensembl", "8", "ENST1234")); |
| 1464 |
1 |
seq.addDBRef(new DBRefEntry("PDB", "0", "1A70")); |
| 1465 |
1 |
seq.addDBRef(new DBRefEntry("PDB", "0", "4BQGa")); |
| 1466 |
1 |
seq.addDBRef(new DBRefEntry("PDB", "0", "3a6sB")); |
| 1467 |
|
|
| 1468 |
1 |
seq.addDBRef(new DBRefEntry("PDB", "0", "2GIS7")); |
| 1469 |
|
|
| 1470 |
1 |
seq.updatePDBIds(); |
| 1471 |
1 |
List<PDBEntry> pdbIds = seq.getAllPDBEntries(); |
| 1472 |
1 |
assertEquals(4, pdbIds.size()); |
| 1473 |
1 |
assertSame(pdbe1, pdbIds.get(0)); |
| 1474 |
|
|
| 1475 |
1 |
assertEquals("B", pdbe1.getChainCode()); |
| 1476 |
1 |
assertEquals("1A70", pdbIds.get(1).getId()); |
| 1477 |
|
|
| 1478 |
1 |
assertEquals("4BQG", pdbIds.get(2).getId()); |
| 1479 |
1 |
assertEquals("a", pdbIds.get(2).getChainCode()); |
| 1480 |
1 |
assertEquals("2GIS7", pdbIds.get(3).getId()); |
| 1481 |
1 |
assertNull(pdbIds.get(3).getChainCode()); |
| 1482 |
|
} |
| 1483 |
|
|
| 1484 |
|
|
| 1485 |
|
|
| 1486 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (45) |
Complexity: 1 |
Complexity Density: 0.02 |
1PASS
|
|
| 1487 |
1 |
@Test(groups = { "Functional" })... |
| 1488 |
|
public void testAddPDBId() |
| 1489 |
|
{ |
| 1490 |
1 |
PDBEntry pdbe = new PDBEntry("3A6S", null, null, null); |
| 1491 |
1 |
seq.addPDBId(pdbe); |
| 1492 |
1 |
assertEquals(1, seq.getAllPDBEntries().size()); |
| 1493 |
1 |
assertSame(pdbe, seq.getPDBEntry("3A6S")); |
| 1494 |
1 |
assertSame(pdbe, seq.getPDBEntry("3a6s")); |
| 1495 |
|
|
| 1496 |
|
|
| 1497 |
1 |
seq.addPDBId(pdbe); |
| 1498 |
1 |
assertEquals(1, seq.getAllPDBEntries().size()); |
| 1499 |
1 |
assertSame(pdbe, seq.getPDBEntry("3A6S")); |
| 1500 |
|
|
| 1501 |
|
|
| 1502 |
1 |
seq.addPDBId(new PDBEntry("3A6S", null, null, null)); |
| 1503 |
1 |
assertEquals(1, seq.getAllPDBEntries().size()); |
| 1504 |
1 |
assertSame(pdbe, seq.getPDBEntry("3A6S")); |
| 1505 |
|
|
| 1506 |
|
|
| 1507 |
1 |
PDBEntry pdbe2 = new PDBEntry("1A70", null, null, null); |
| 1508 |
1 |
seq.addPDBId(pdbe2); |
| 1509 |
1 |
assertEquals(2, seq.getAllPDBEntries().size()); |
| 1510 |
1 |
assertSame(pdbe, seq.getAllPDBEntries().get(0)); |
| 1511 |
1 |
assertSame(pdbe2, seq.getAllPDBEntries().get(1)); |
| 1512 |
|
|
| 1513 |
|
|
| 1514 |
1 |
PDBEntry pdbe3 = new PDBEntry("3a6s", "A", Type.PDB, "filepath"); |
| 1515 |
1 |
seq.addPDBId(pdbe3); |
| 1516 |
1 |
assertEquals(2, seq.getAllPDBEntries().size()); |
| 1517 |
1 |
assertSame(pdbe, seq.getAllPDBEntries().get(0)); |
| 1518 |
1 |
assertEquals("3A6S", pdbe.getId()); |
| 1519 |
1 |
assertEquals("A", pdbe.getChainCode()); |
| 1520 |
1 |
assertEquals(Type.PDB.toString(), pdbe.getType()); |
| 1521 |
1 |
assertEquals("filepath", pdbe.getFile()); |
| 1522 |
1 |
assertSame(pdbe2, seq.getAllPDBEntries().get(1)); |
| 1523 |
|
|
| 1524 |
|
|
| 1525 |
1 |
PDBEntry pdbe4 = new PDBEntry("3a6s", "A", Type.PDB, "filepath2"); |
| 1526 |
1 |
seq.addPDBId(pdbe4); |
| 1527 |
1 |
assertEquals(3, seq.getAllPDBEntries().size()); |
| 1528 |
1 |
assertSame(pdbe4, seq.getAllPDBEntries().get(2)); |
| 1529 |
|
|
| 1530 |
|
|
| 1531 |
1 |
PDBEntry pdbe5 = new PDBEntry("3a6s", "B", Type.PDB, "filepath"); |
| 1532 |
1 |
seq.addPDBId(pdbe5); |
| 1533 |
1 |
assertEquals(4, seq.getAllPDBEntries().size()); |
| 1534 |
1 |
assertSame(pdbe5, seq.getAllPDBEntries().get(3)); |
| 1535 |
|
|
| 1536 |
|
|
| 1537 |
|
|
| 1538 |
1 |
String realId = "RealIDQ"; |
| 1539 |
1 |
PDBEntry pdbe6 = new PDBEntry(realId, null, Type.PDB, "real/localpath"); |
| 1540 |
1 |
PDBEntry pdbe7 = new PDBEntry("RealID/real/localpath", "C", Type.MMCIF, |
| 1541 |
|
"real/localpath"); |
| 1542 |
1 |
pdbe7.setFakedPDBId(true); |
| 1543 |
1 |
seq.addPDBId(pdbe6); |
| 1544 |
1 |
assertEquals(5, seq.getAllPDBEntries().size()); |
| 1545 |
1 |
seq.addPDBId(pdbe7); |
| 1546 |
1 |
assertEquals(5, seq.getAllPDBEntries().size()); |
| 1547 |
1 |
assertFalse(pdbe6.fakedPDBId()); |
| 1548 |
1 |
assertSame(pdbe6, seq.getAllPDBEntries().get(4)); |
| 1549 |
1 |
assertEquals("C", pdbe6.getChainCode()); |
| 1550 |
1 |
assertEquals(realId, pdbe6.getId()); |
| 1551 |
|
} |
| 1552 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (1) |
Complexity: 1 |
Complexity Density: 1 |
1PASS
|
|
| 1553 |
1 |
@Test(... |
| 1554 |
|
groups = |
| 1555 |
|
{ "Functional" }, |
| 1556 |
|
expectedExceptions = |
| 1557 |
|
{ IllegalArgumentException.class }) |
| 1558 |
|
public void testSetDatasetSequence_toSelf() |
| 1559 |
|
{ |
| 1560 |
1 |
seq.setDatasetSequence(seq); |
| 1561 |
|
} |
| 1562 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (3) |
Complexity: 1 |
Complexity Density: 0.33 |
1PASS
|
|
| 1563 |
1 |
@Test(... |
| 1564 |
|
groups = |
| 1565 |
|
{ "Functional" }, |
| 1566 |
|
expectedExceptions = |
| 1567 |
|
{ IllegalArgumentException.class }) |
| 1568 |
|
public void testSetDatasetSequence_cascading() |
| 1569 |
|
{ |
| 1570 |
1 |
SequenceI seq2 = new Sequence("Seq2", "xyz"); |
| 1571 |
1 |
seq2.createDatasetSequence(); |
| 1572 |
1 |
seq.setDatasetSequence(seq2); |
| 1573 |
|
} |
| 1574 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (34) |
Complexity: 1 |
Complexity Density: 0.03 |
1PASS
|
|
| 1575 |
1 |
@Test(groups = { "Functional" })... |
| 1576 |
|
public void testFindFeatures() |
| 1577 |
|
{ |
| 1578 |
1 |
SequenceI sq = new Sequence("test/8-16", "-ABC--DEF--GHI--"); |
| 1579 |
1 |
sq.createDatasetSequence(); |
| 1580 |
|
|
| 1581 |
1 |
assertTrue(sq.findFeatures(1, 99).isEmpty()); |
| 1582 |
|
|
| 1583 |
|
|
| 1584 |
1 |
SequenceFeature sf0 = new SequenceFeature("Cath", "desc", 0, 0, 2f, |
| 1585 |
|
null); |
| 1586 |
1 |
sq.addSequenceFeature(sf0); |
| 1587 |
|
|
| 1588 |
1 |
SequenceFeature sfBCD = new SequenceFeature("Cath", "desc", 9, 11, 2f, |
| 1589 |
|
null); |
| 1590 |
1 |
sq.addSequenceFeature(sfBCD); |
| 1591 |
|
|
| 1592 |
1 |
SequenceFeature sfDE = new SequenceFeature("Cath", "desc", 11, 12, 2f, |
| 1593 |
|
null); |
| 1594 |
1 |
sq.addSequenceFeature(sfDE); |
| 1595 |
|
|
| 1596 |
1 |
SequenceFeature sfContactBH = new SequenceFeature("Disulphide bond", |
| 1597 |
|
"desc", 9, 15, 2f, null); |
| 1598 |
1 |
sq.addSequenceFeature(sfContactBH); |
| 1599 |
|
|
| 1600 |
1 |
SequenceFeature sfContactFG = new SequenceFeature("Disulfide Bond", |
| 1601 |
|
"desc", 13, 14, 2f, null); |
| 1602 |
1 |
sq.addSequenceFeature(sfContactFG); |
| 1603 |
|
|
| 1604 |
1 |
SequenceFeature sfI = new SequenceFeature("Disulfide Bond", "desc", 16, |
| 1605 |
|
16, null); |
| 1606 |
1 |
sq.addSequenceFeature(sfI); |
| 1607 |
|
|
| 1608 |
|
|
| 1609 |
1 |
List<SequenceFeature> found = sq.findFeatures(1, 2); |
| 1610 |
1 |
assertTrue(found.isEmpty()); |
| 1611 |
|
|
| 1612 |
|
|
| 1613 |
1 |
found = sq.findFeatures(1, 6); |
| 1614 |
1 |
assertEquals(2, found.size()); |
| 1615 |
1 |
assertTrue(found.contains(sfBCD)); |
| 1616 |
1 |
assertTrue(found.contains(sfContactBH)); |
| 1617 |
|
|
| 1618 |
|
|
| 1619 |
1 |
found = sq.findFeatures(5, 6); |
| 1620 |
1 |
assertEquals(1, found.size()); |
| 1621 |
1 |
assertTrue(found.contains(sfBCD)); |
| 1622 |
|
|
| 1623 |
|
|
| 1624 |
1 |
found = sq.findFeatures(7, 10); |
| 1625 |
1 |
assertEquals(3, found.size()); |
| 1626 |
1 |
assertTrue(found.contains(sfBCD)); |
| 1627 |
1 |
assertTrue(found.contains(sfDE)); |
| 1628 |
1 |
assertTrue(found.contains(sfContactFG)); |
| 1629 |
|
|
| 1630 |
|
|
| 1631 |
1 |
found = sq.findFeatures(10, 11); |
| 1632 |
1 |
assertEquals(0, found.size()); |
| 1633 |
|
|
| 1634 |
|
|
| 1635 |
1 |
found = sq.findFeatures(14, 14); |
| 1636 |
1 |
assertEquals(1, found.size()); |
| 1637 |
1 |
assertTrue(found.contains(sfI)); |
| 1638 |
|
} |
| 1639 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (40) |
Complexity: 1 |
Complexity Density: 0.03 |
1PASS
|
|
| 1640 |
1 |
@Test(groups = { "Functional" })... |
| 1641 |
|
public void testFindIndex_withCursor() |
| 1642 |
|
{ |
| 1643 |
1 |
Sequence sq = new Sequence("test/8-13", "-A--BCD-EF--"); |
| 1644 |
1 |
final int tok = (int) PA.getValue(sq, "changeCount"); |
| 1645 |
1 |
assertEquals(1, tok); |
| 1646 |
|
|
| 1647 |
|
|
| 1648 |
1 |
assertEquals(10, sq.findIndex(13, new SequenceCursor(sq, 8, 2, tok))); |
| 1649 |
1 |
SequenceCursor cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 1650 |
1 |
assertEquals(13, cursor.residuePosition); |
| 1651 |
1 |
assertEquals(10, cursor.columnPosition); |
| 1652 |
|
|
| 1653 |
|
|
| 1654 |
1 |
assertEquals(2, sq.findIndex(8, new SequenceCursor(sq, 13, 10, tok))); |
| 1655 |
1 |
cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 1656 |
1 |
assertEquals(8, cursor.residuePosition); |
| 1657 |
1 |
assertEquals(2, cursor.columnPosition); |
| 1658 |
|
|
| 1659 |
|
|
| 1660 |
1 |
assertEquals(6, sq.findIndex(10, new SequenceCursor(sq, 10, 6, tok))); |
| 1661 |
1 |
SequenceCursor cursor2 = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 1662 |
1 |
assertSame(cursor2, cursor); |
| 1663 |
|
|
| 1664 |
|
|
| 1665 |
|
|
| 1666 |
|
|
| 1667 |
|
|
| 1668 |
|
|
| 1669 |
1 |
sq = new Sequence("test/8-99", "-A--B-C-D-E-F--"); |
| 1670 |
1 |
assertEquals(7, sq.findIndex(10)); |
| 1671 |
1 |
cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 1672 |
1 |
assertEquals(10, cursor.residuePosition); |
| 1673 |
1 |
assertEquals(7, cursor.columnPosition); |
| 1674 |
1 |
assertEquals(sq.getLength(), sq.findIndex(65)); |
| 1675 |
1 |
cursor2 = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 1676 |
1 |
assertSame(cursor, cursor2); |
| 1677 |
|
|
| 1678 |
1 |
sq = new Sequence("test/8-99", "-A--B-C-D-E-F"); |
| 1679 |
1 |
sq.findIndex(10); |
| 1680 |
1 |
cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 1681 |
1 |
assertEquals(sq.getLength(), sq.findIndex(65)); |
| 1682 |
1 |
cursor2 = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 1683 |
1 |
assertSame(cursor, cursor2); |
| 1684 |
|
|
| 1685 |
|
|
| 1686 |
|
|
| 1687 |
|
|
| 1688 |
|
|
| 1689 |
1 |
sq = new Sequence("test/8-15", "-A-B-C-"); |
| 1690 |
1 |
sq.findIndex(10); |
| 1691 |
1 |
cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 1692 |
1 |
assertEquals(0, sq.findIndex(3)); |
| 1693 |
1 |
cursor2 = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 1694 |
1 |
assertSame(cursor, cursor2); |
| 1695 |
|
|
| 1696 |
1 |
sq = new Sequence("test/8-15", "A-B-C-"); |
| 1697 |
1 |
sq.findIndex(10); |
| 1698 |
1 |
cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 1699 |
1 |
assertEquals(0, sq.findIndex(2)); |
| 1700 |
1 |
cursor2 = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 1701 |
1 |
assertSame(cursor, cursor2); |
| 1702 |
|
} |
| 1703 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (23) |
Complexity: 1 |
Complexity Density: 0.04 |
1PASS
|
|
| 1704 |
1 |
@Test(groups = { "Functional" })... |
| 1705 |
|
public void testFindPosition_withCursor() |
| 1706 |
|
{ |
| 1707 |
1 |
Sequence sq = new Sequence("test/8-13", "-A--BCD-EF--"); |
| 1708 |
1 |
final int tok = (int) PA.getValue(sq, "changeCount"); |
| 1709 |
1 |
assertEquals(1, tok); |
| 1710 |
|
|
| 1711 |
|
|
| 1712 |
1 |
assertEquals(13, |
| 1713 |
|
sq.findPosition(10, new SequenceCursor(sq, 8, 2, tok))); |
| 1714 |
1 |
assertEquals("test:Pos13:Col10:startCol0:endCol10:tok1", |
| 1715 |
|
PA.getValue(sq, "cursor").toString()); |
| 1716 |
|
|
| 1717 |
|
|
| 1718 |
1 |
assertEquals(8, |
| 1719 |
|
sq.findPosition(2, new SequenceCursor(sq, 13, 10, tok))); |
| 1720 |
1 |
assertEquals("test:Pos8:Col2:startCol2:endCol10:tok1", |
| 1721 |
|
PA.getValue(sq, "cursor").toString()); |
| 1722 |
|
|
| 1723 |
|
|
| 1724 |
1 |
assertEquals(10, |
| 1725 |
|
sq.findPosition(6, new SequenceCursor(sq, 10, 6, tok))); |
| 1726 |
1 |
assertEquals("test:Pos10:Col6:startCol0:endCol0:tok1", |
| 1727 |
|
PA.getValue(sq, "cursor").toString()); |
| 1728 |
|
|
| 1729 |
|
|
| 1730 |
|
|
| 1731 |
|
|
| 1732 |
|
|
| 1733 |
1 |
assertEquals(9, sq.findPosition(3, new SequenceCursor(sq, 11, 7, tok))); |
| 1734 |
1 |
assertEquals("test:Pos9:Col5:startCol0:endCol0:tok1", |
| 1735 |
|
PA.getValue(sq, "cursor").toString()); |
| 1736 |
|
|
| 1737 |
|
|
| 1738 |
|
|
| 1739 |
1 |
assertEquals(12, |
| 1740 |
|
sq.findPosition(8, new SequenceCursor(sq, 11, 7, tok))); |
| 1741 |
1 |
assertEquals("test:Pos11:Col7:startCol0:endCol0:tok1", |
| 1742 |
|
PA.getValue(sq, "cursor").toString()); |
| 1743 |
|
|
| 1744 |
|
|
| 1745 |
|
|
| 1746 |
|
|
| 1747 |
1 |
assertEquals(14, |
| 1748 |
|
sq.findPosition(12, new SequenceCursor(sq, 9, 5, tok))); |
| 1749 |
1 |
assertEquals("test:Pos13:Col10:startCol0:endCol10:tok1", |
| 1750 |
|
PA.getValue(sq, "cursor").toString()); |
| 1751 |
|
|
| 1752 |
|
|
| 1753 |
|
|
| 1754 |
|
|
| 1755 |
|
|
| 1756 |
|
|
| 1757 |
1 |
assertEquals(14, |
| 1758 |
|
sq.findPosition(99, new SequenceCursor(sq, 8, 2, tok))); |
| 1759 |
1 |
assertEquals("test:Pos13:Col10:startCol0:endCol10:tok1", |
| 1760 |
|
PA.getValue(sq, "cursor").toString()); |
| 1761 |
|
|
| 1762 |
|
|
| 1763 |
|
|
| 1764 |
|
|
| 1765 |
1 |
sq = new Sequence("test/8-13", "-A--BCD-EF"); |
| 1766 |
|
|
| 1767 |
1 |
assertEquals(10, sq.findPosition(6, new SequenceCursor(sq, 8, 2, tok))); |
| 1768 |
1 |
SequenceCursor cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 1769 |
1 |
assertEquals("test:Pos10:Col6:startCol0:endCol0:tok1", |
| 1770 |
|
cursor.toString()); |
| 1771 |
|
|
| 1772 |
|
|
| 1773 |
1 |
assertEquals(14, sq.findPosition(99, cursor)); |
| 1774 |
1 |
assertEquals("test:Pos13:Col10:startCol0:endCol10:tok1", |
| 1775 |
|
PA.getValue(sq, "cursor").toString()); |
| 1776 |
|
} |
| 1777 |
|
|
| |
|
| 0% |
Uncovered Elements: 21 (21) |
Complexity: 1 |
Complexity Density: 0.05 |
1PASS
|
|
| 1778 |
0 |
@Test... |
| 1779 |
|
public void testIsValidCursor() |
| 1780 |
|
{ |
| 1781 |
0 |
Sequence sq = new Sequence("Seq", "ABC--DE-F", 8, 13); |
| 1782 |
0 |
assertFalse(sq.isValidCursor(null)); |
| 1783 |
|
|
| 1784 |
|
|
| 1785 |
|
|
| 1786 |
|
|
| 1787 |
|
|
| 1788 |
0 |
int changeCount = (int) PA.getValue(sq, "changeCount"); |
| 1789 |
0 |
SequenceCursor cursor = new SequenceCursor(sq, 13, 1, changeCount); |
| 1790 |
0 |
assertTrue(sq.isValidCursor(cursor)); |
| 1791 |
|
|
| 1792 |
|
|
| 1793 |
|
|
| 1794 |
|
|
| 1795 |
0 |
cursor = new SequenceCursor(sq, 13, -1, changeCount); |
| 1796 |
0 |
assertFalse(sq.isValidCursor(cursor)); |
| 1797 |
0 |
cursor = new SequenceCursor(sq, 13, 10, changeCount); |
| 1798 |
0 |
assertFalse(sq.isValidCursor(cursor)); |
| 1799 |
0 |
cursor = new SequenceCursor(sq, 7, 8, changeCount); |
| 1800 |
0 |
assertFalse(sq.isValidCursor(cursor)); |
| 1801 |
0 |
cursor = new SequenceCursor(sq, 14, 2, changeCount); |
| 1802 |
0 |
assertFalse(sq.isValidCursor(cursor)); |
| 1803 |
|
|
| 1804 |
|
|
| 1805 |
|
|
| 1806 |
|
|
| 1807 |
0 |
cursor = new SequenceCursor(null, 13, 1, changeCount); |
| 1808 |
0 |
assertFalse(sq.isValidCursor(cursor)); |
| 1809 |
0 |
cursor = new SequenceCursor(new Sequence("Seq", "abc"), 13, 1, |
| 1810 |
|
changeCount); |
| 1811 |
0 |
assertFalse(sq.isValidCursor(cursor)); |
| 1812 |
|
|
| 1813 |
|
|
| 1814 |
|
|
| 1815 |
|
|
| 1816 |
0 |
cursor = new SequenceCursor(sq, 13, 1, changeCount + 1); |
| 1817 |
0 |
assertFalse(sq.isValidCursor(cursor)); |
| 1818 |
0 |
cursor = new SequenceCursor(sq, 13, 1, changeCount - 1); |
| 1819 |
0 |
assertFalse(sq.isValidCursor(cursor)); |
| 1820 |
|
} |
| 1821 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (39) |
Complexity: 1 |
Complexity Density: 0.03 |
1PASS
|
|
| 1822 |
1 |
@Test(groups = { "Functional" })... |
| 1823 |
|
public void testFindPosition_withCursorAndEdits() |
| 1824 |
|
{ |
| 1825 |
1 |
Sequence sq = new Sequence("test/8-13", "-A--BCD-EF--"); |
| 1826 |
|
|
| 1827 |
|
|
| 1828 |
1 |
assertEquals(13, sq.findPosition(10, new SequenceCursor(sq, 8, 2, 0))); |
| 1829 |
1 |
int token = (int) PA.getValue(sq, "changeCount"); |
| 1830 |
1 |
SequenceCursor cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 1831 |
1 |
assertEquals(new SequenceCursor(sq, 13, 10, token), cursor); |
| 1832 |
|
|
| 1833 |
|
|
| 1834 |
|
|
| 1835 |
|
|
| 1836 |
1 |
sq.setSequence("-A-BCD-EF---"); |
| 1837 |
1 |
assertEquals(8, sq.getStart()); |
| 1838 |
1 |
assertEquals(11, sq.findPosition(5)); |
| 1839 |
|
|
| 1840 |
1 |
cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 1841 |
1 |
assertEquals(new SequenceCursor(sq, 11, 6, ++token), cursor); |
| 1842 |
1 |
assertEquals(0, cursor.lastColumnPosition); |
| 1843 |
1 |
assertEquals(13, sq.findPosition(8)); |
| 1844 |
1 |
cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 1845 |
1 |
assertEquals(9, cursor.lastColumnPosition); |
| 1846 |
|
|
| 1847 |
|
|
| 1848 |
|
|
| 1849 |
|
|
| 1850 |
1 |
sq.deleteChars(2, 5); |
| 1851 |
1 |
assertEquals("-AD-EF---", sq.getSequenceAsString()); |
| 1852 |
1 |
assertEquals(8, sq.getStart()); |
| 1853 |
1 |
assertEquals(10, sq.findPosition(4)); |
| 1854 |
|
|
| 1855 |
1 |
cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 1856 |
1 |
assertEquals(new SequenceCursor(sq, 10, 5, ++token), cursor); |
| 1857 |
|
|
| 1858 |
|
|
| 1859 |
|
|
| 1860 |
|
|
| 1861 |
|
|
| 1862 |
1 |
SequenceI[] seqs = new SequenceI[] { sq }; |
| 1863 |
1 |
AlignmentI al = new Alignment(seqs); |
| 1864 |
1 |
new EditCommand().appendEdit(Action.INSERT_GAP, seqs, 3, 2, al, true); |
| 1865 |
1 |
assertEquals("-AD---EF---", sq.getSequenceAsString()); |
| 1866 |
1 |
assertEquals(10, sq.findPosition(4)); |
| 1867 |
|
|
| 1868 |
1 |
cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 1869 |
1 |
assertEquals(new SequenceCursor(sq, 9, 3, ++token), cursor); |
| 1870 |
|
|
| 1871 |
|
|
| 1872 |
|
|
| 1873 |
|
|
| 1874 |
|
|
| 1875 |
1 |
sq.insertCharAt(4, 2, 'C'); |
| 1876 |
1 |
assertEquals("-AD-CC--EF---", sq.getSequenceAsString()); |
| 1877 |
1 |
assertEquals(13, sq.findPosition(9)); |
| 1878 |
|
|
| 1879 |
1 |
cursor = (SequenceCursor) PA.getValue(sq, "cursor"); |
| 1880 |
1 |
assertEquals(new SequenceCursor(sq, 13, 10, ++token), cursor); |
| 1881 |
|
|
| 1882 |
|
|
| 1883 |
|
|
| 1884 |
|
|
| 1885 |
1 |
sq = new Sequence("test/8-13", "-A--BCD-EF--"); |
| 1886 |
1 |
assertEquals(8, sq.getStart()); |
| 1887 |
1 |
assertEquals(9, sq.findPosition(4)); |
| 1888 |
1 |
sq.setStart(7); |
| 1889 |
1 |
assertEquals(8, sq.findPosition(4)); |
| 1890 |
1 |
sq.setStart(10); |
| 1891 |
1 |
assertEquals(11, sq.findPosition(4)); |
| 1892 |
|
} |
| 1893 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (9) |
Complexity: 1 |
Complexity Density: 0.11 |
1PASS
|
|
| 1894 |
1 |
@Test(groups = { "Functional" })... |
| 1895 |
|
public void testGetSequence() |
| 1896 |
|
{ |
| 1897 |
1 |
String seqstring = "-A--BCD-EF--"; |
| 1898 |
1 |
Sequence sq = new Sequence("test/8-13", seqstring); |
| 1899 |
1 |
sq.createDatasetSequence(); |
| 1900 |
1 |
assertTrue(Arrays.equals(sq.getSequence(), seqstring.toCharArray())); |
| 1901 |
1 |
assertTrue(Arrays.equals(sq.getDatasetSequence().getSequence(), |
| 1902 |
|
"ABCDEF".toCharArray())); |
| 1903 |
|
|
| 1904 |
|
|
| 1905 |
1 |
char[] theSeq = (char[]) PA.getValue(sq, "sequence"); |
| 1906 |
1 |
assertNotSame(theSeq, sq.getSequence()); |
| 1907 |
1 |
theSeq = (char[]) PA.getValue(sq.getDatasetSequence(), "sequence"); |
| 1908 |
1 |
assertNotSame(theSeq, sq.getDatasetSequence().getSequence()); |
| 1909 |
|
} |
| 1910 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (15) |
Complexity: 1 |
Complexity Density: 0.07 |
1PASS
|
|
| 1911 |
1 |
@Test(groups = { "Functional" })... |
| 1912 |
|
public void testReplace() |
| 1913 |
|
{ |
| 1914 |
1 |
String seqstring = "-A--BCD-EF--"; |
| 1915 |
1 |
SequenceI sq = new Sequence("test/8-13", seqstring); |
| 1916 |
|
|
| 1917 |
1 |
assertEquals(1, PA.getValue(sq, "changeCount")); |
| 1918 |
|
|
| 1919 |
1 |
assertEquals(0, sq.replace('A', 'A')); |
| 1920 |
1 |
assertEquals(seqstring, sq.getSequenceAsString()); |
| 1921 |
1 |
assertEquals(1, PA.getValue(sq, "changeCount")); |
| 1922 |
|
|
| 1923 |
1 |
assertEquals(0, sq.replace('X', 'Y')); |
| 1924 |
1 |
assertEquals(seqstring, sq.getSequenceAsString()); |
| 1925 |
1 |
assertEquals(1, PA.getValue(sq, "changeCount")); |
| 1926 |
|
|
| 1927 |
1 |
assertEquals(1, sq.replace('A', 'K')); |
| 1928 |
1 |
assertEquals("-K--BCD-EF--", sq.getSequenceAsString()); |
| 1929 |
1 |
assertEquals(2, PA.getValue(sq, "changeCount")); |
| 1930 |
|
|
| 1931 |
1 |
assertEquals(6, sq.replace('-', '.')); |
| 1932 |
1 |
assertEquals(".K..BCD.EF..", sq.getSequenceAsString()); |
| 1933 |
1 |
assertEquals(3, PA.getValue(sq, "changeCount")); |
| 1934 |
|
} |
| 1935 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (8) |
Complexity: 1 |
Complexity Density: 0.12 |
1PASS
|
|
| 1936 |
1 |
@Test(groups = { "Functional" })... |
| 1937 |
|
public void testGapBitset() |
| 1938 |
|
{ |
| 1939 |
1 |
SequenceI sq = new Sequence("test/8-13", "-ABC---DE-F--"); |
| 1940 |
1 |
BitSet bs = sq.gapBitset(); |
| 1941 |
1 |
BitSet expected = new BitSet(); |
| 1942 |
1 |
expected.set(0); |
| 1943 |
1 |
expected.set(4, 7); |
| 1944 |
1 |
expected.set(9); |
| 1945 |
1 |
expected.set(11, 13); |
| 1946 |
|
|
| 1947 |
1 |
assertTrue(bs.equals(expected)); |
| 1948 |
|
|
| 1949 |
|
} |
| 1950 |
|
|
| |
|
| 0% |
Uncovered Elements: 13 (13) |
Complexity: 1 |
Complexity Density: 0.08 |
1PASS
|
|
| 1951 |
0 |
public void testFindFeatures_largeEndPos()... |
| 1952 |
|
{ |
| 1953 |
|
|
| 1954 |
|
|
| 1955 |
|
|
| 1956 |
0 |
SequenceI sq = new Sequence("test", "-ABC--DEF--", 1, 20); |
| 1957 |
0 |
sq.createDatasetSequence(); |
| 1958 |
|
|
| 1959 |
0 |
assertTrue(sq.findFeatures(1, 9).isEmpty()); |
| 1960 |
|
|
| 1961 |
0 |
assertTrue(sq.findFeatures(1, 15).isEmpty()); |
| 1962 |
|
|
| 1963 |
|
|
| 1964 |
0 |
SequenceFeature sfBCD = new SequenceFeature("Cath", "desc", 2, 4, 2f, |
| 1965 |
|
null); |
| 1966 |
0 |
sq.addSequenceFeature(sfBCD); |
| 1967 |
|
|
| 1968 |
|
|
| 1969 |
0 |
List<SequenceFeature> found = sq.findFeatures(1, 2); |
| 1970 |
0 |
assertTrue(found.isEmpty()); |
| 1971 |
|
|
| 1972 |
|
|
| 1973 |
0 |
found = sq.findFeatures(1, 6); |
| 1974 |
0 |
assertEquals(1, found.size()); |
| 1975 |
0 |
assertTrue(found.contains(sfBCD)); |
| 1976 |
|
|
| 1977 |
|
|
| 1978 |
0 |
found = sq.findFeatures(10, 11); |
| 1979 |
0 |
assertEquals(0, found.size()); |
| 1980 |
|
} |
| 1981 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (58) |
Complexity: 1 |
Complexity Density: 0.02 |
1PASS
|
|
| 1982 |
1 |
@Test(groups = { "Functional" })... |
| 1983 |
|
public void testSetName() |
| 1984 |
|
{ |
| 1985 |
1 |
SequenceI sq = new Sequence("test", "-ABC---DE-F--"); |
| 1986 |
1 |
assertEquals("test", sq.getName()); |
| 1987 |
1 |
assertEquals(1, sq.getStart()); |
| 1988 |
1 |
assertEquals(6, sq.getEnd()); |
| 1989 |
|
|
| 1990 |
1 |
sq.setName("testing"); |
| 1991 |
1 |
assertEquals("testing", sq.getName()); |
| 1992 |
|
|
| 1993 |
1 |
sq.setName("test/8-10"); |
| 1994 |
1 |
assertEquals("test", sq.getName()); |
| 1995 |
1 |
assertEquals(8, sq.getStart()); |
| 1996 |
1 |
assertEquals(13, sq.getEnd()); |
| 1997 |
|
|
| 1998 |
1 |
sq.setName("testing/7-99"); |
| 1999 |
1 |
assertEquals("testing", sq.getName()); |
| 2000 |
1 |
assertEquals(7, sq.getStart()); |
| 2001 |
1 |
assertEquals(99, sq.getEnd()); |
| 2002 |
|
|
| 2003 |
1 |
sq.setName("/2-3"); |
| 2004 |
1 |
assertEquals("", sq.getName()); |
| 2005 |
1 |
assertEquals(2, sq.getStart()); |
| 2006 |
1 |
assertEquals(7, sq.getEnd()); |
| 2007 |
|
|
| 2008 |
1 |
sq.setName("test/"); |
| 2009 |
1 |
assertEquals("test/", sq.getName()); |
| 2010 |
1 |
assertEquals(2, sq.getStart()); |
| 2011 |
1 |
assertEquals(7, sq.getEnd()); |
| 2012 |
|
|
| 2013 |
1 |
sq.setName("test/6-13/7-99"); |
| 2014 |
1 |
assertEquals("test/6-13", sq.getName()); |
| 2015 |
1 |
assertEquals(7, sq.getStart()); |
| 2016 |
1 |
assertEquals(99, sq.getEnd()); |
| 2017 |
|
|
| 2018 |
1 |
sq.setName("test/0-5"); |
| 2019 |
1 |
assertEquals("test/0-5", sq.getName()); |
| 2020 |
1 |
assertEquals(7, sq.getStart()); |
| 2021 |
1 |
assertEquals(99, sq.getEnd()); |
| 2022 |
|
|
| 2023 |
1 |
sq.setName("test/a-5"); |
| 2024 |
1 |
assertEquals("test/a-5", sq.getName()); |
| 2025 |
1 |
assertEquals(7, sq.getStart()); |
| 2026 |
1 |
assertEquals(99, sq.getEnd()); |
| 2027 |
|
|
| 2028 |
1 |
sq.setName("test/6-5"); |
| 2029 |
1 |
assertEquals("test/6-5", sq.getName()); |
| 2030 |
1 |
assertEquals(7, sq.getStart()); |
| 2031 |
1 |
assertEquals(99, sq.getEnd()); |
| 2032 |
|
|
| 2033 |
1 |
sq.setName("test/5"); |
| 2034 |
1 |
assertEquals("test/5", sq.getName()); |
| 2035 |
1 |
assertEquals(7, sq.getStart()); |
| 2036 |
1 |
assertEquals(99, sq.getEnd()); |
| 2037 |
|
|
| 2038 |
1 |
sq.setName("test/-5"); |
| 2039 |
1 |
assertEquals("test/-5", sq.getName()); |
| 2040 |
1 |
assertEquals(7, sq.getStart()); |
| 2041 |
1 |
assertEquals(99, sq.getEnd()); |
| 2042 |
|
|
| 2043 |
1 |
sq.setName("test/5-"); |
| 2044 |
1 |
assertEquals("test/5-", sq.getName()); |
| 2045 |
1 |
assertEquals(7, sq.getStart()); |
| 2046 |
1 |
assertEquals(99, sq.getEnd()); |
| 2047 |
|
|
| 2048 |
1 |
sq.setName("test/5-6-7"); |
| 2049 |
1 |
assertEquals("test/5-6-7", sq.getName()); |
| 2050 |
1 |
assertEquals(7, sq.getStart()); |
| 2051 |
1 |
assertEquals(99, sq.getEnd()); |
| 2052 |
|
|
| 2053 |
1 |
sq.setName(null); |
| 2054 |
1 |
assertEquals("", sq.getName()); |
| 2055 |
1 |
assertEquals(7, sq.getStart()); |
| 2056 |
1 |
assertEquals(99, sq.getEnd()); |
| 2057 |
|
} |
| 2058 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (9) |
Complexity: 1 |
Complexity Density: 0.11 |
1PASS
|
|
| 2059 |
1 |
@Test(groups = { "Functional" })... |
| 2060 |
|
public void testCheckValidRange() |
| 2061 |
|
{ |
| 2062 |
1 |
Sequence sq = new Sequence("test/7-12", "-ABC---DE-F--"); |
| 2063 |
1 |
assertEquals(7, sq.getStart()); |
| 2064 |
1 |
assertEquals(12, sq.getEnd()); |
| 2065 |
|
|
| 2066 |
|
|
| 2067 |
|
|
| 2068 |
|
|
| 2069 |
1 |
PA.setValue(sq, "end", 2); |
| 2070 |
1 |
sq.checkValidRange(); |
| 2071 |
1 |
assertEquals(12, sq.getEnd()); |
| 2072 |
|
|
| 2073 |
|
|
| 2074 |
|
|
| 2075 |
|
|
| 2076 |
1 |
PA.setValue(sq, "end", 22); |
| 2077 |
1 |
sq.checkValidRange(); |
| 2078 |
1 |
assertEquals(22, sq.getEnd()); |
| 2079 |
|
} |
| 2080 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (49) |
Complexity: 1 |
Complexity Density: 0.02 |
1PASS
|
|
| 2081 |
1 |
@Test(groups = { "Functional" })... |
| 2082 |
|
public void testDeleteChars_withGaps() |
| 2083 |
|
{ |
| 2084 |
|
|
| 2085 |
|
|
| 2086 |
|
|
| 2087 |
1 |
SequenceI sq = new Sequence("test/8-10", "A-B-C"); |
| 2088 |
1 |
sq.createDatasetSequence(); |
| 2089 |
1 |
assertEquals("ABC", sq.getDatasetSequence().getSequenceAsString()); |
| 2090 |
1 |
sq.deleteChars(1, 2); |
| 2091 |
1 |
assertEquals("AB-C", sq.getSequenceAsString()); |
| 2092 |
1 |
assertEquals(8, sq.getStart()); |
| 2093 |
1 |
assertEquals(10, sq.getEnd()); |
| 2094 |
1 |
assertEquals("ABC", sq.getDatasetSequence().getSequenceAsString()); |
| 2095 |
|
|
| 2096 |
|
|
| 2097 |
|
|
| 2098 |
|
|
| 2099 |
1 |
sq = new Sequence("test/8-10", "A-B-C"); |
| 2100 |
1 |
sq.createDatasetSequence(); |
| 2101 |
1 |
sq.deleteChars(0, 3); |
| 2102 |
1 |
assertEquals("-C", sq.getSequenceAsString()); |
| 2103 |
1 |
assertEquals(10, sq.getStart()); |
| 2104 |
1 |
assertEquals(10, sq.getEnd()); |
| 2105 |
1 |
assertEquals("ABC", sq.getDatasetSequence().getSequenceAsString()); |
| 2106 |
|
|
| 2107 |
|
|
| 2108 |
|
|
| 2109 |
|
|
| 2110 |
1 |
sq = new Sequence("test/8-10", "A-B-C"); |
| 2111 |
1 |
sq.createDatasetSequence(); |
| 2112 |
1 |
sq.deleteChars(2, 5); |
| 2113 |
1 |
assertEquals("A-", sq.getSequenceAsString()); |
| 2114 |
1 |
assertEquals(8, sq.getStart()); |
| 2115 |
1 |
assertEquals(8, sq.getEnd()); |
| 2116 |
1 |
assertEquals("ABC", sq.getDatasetSequence().getSequenceAsString()); |
| 2117 |
|
|
| 2118 |
|
|
| 2119 |
|
|
| 2120 |
|
|
| 2121 |
|
|
| 2122 |
1 |
sq = new Sequence("test/8-10", "A-B-C"); |
| 2123 |
1 |
sq.createDatasetSequence(); |
| 2124 |
1 |
sq.deleteChars(1, 3); |
| 2125 |
1 |
assertEquals("A-C", sq.getSequenceAsString()); |
| 2126 |
1 |
assertEquals(8, sq.getStart()); |
| 2127 |
1 |
assertEquals(9, sq.getEnd()); |
| 2128 |
1 |
assertEquals("AC", sq.getDatasetSequence().getSequenceAsString()); |
| 2129 |
1 |
assertEquals(8, sq.getDatasetSequence().getStart()); |
| 2130 |
1 |
assertEquals(9, sq.getDatasetSequence().getEnd()); |
| 2131 |
|
|
| 2132 |
|
|
| 2133 |
|
|
| 2134 |
|
|
| 2135 |
1 |
sq = new Sequence("test/8-10", "A-B-C"); |
| 2136 |
1 |
sq.createDatasetSequence(); |
| 2137 |
1 |
sq.deleteChars(1, 4); |
| 2138 |
1 |
assertEquals("AC", sq.getSequenceAsString()); |
| 2139 |
1 |
assertEquals(8, sq.getStart()); |
| 2140 |
1 |
assertEquals(9, sq.getEnd()); |
| 2141 |
1 |
assertEquals("AC", sq.getDatasetSequence().getSequenceAsString()); |
| 2142 |
1 |
assertEquals(8, sq.getDatasetSequence().getStart()); |
| 2143 |
1 |
assertEquals(9, sq.getDatasetSequence().getEnd()); |
| 2144 |
|
|
| 2145 |
|
|
| 2146 |
|
|
| 2147 |
|
|
| 2148 |
1 |
sq = new Sequence("test/8-10", "A-B-C"); |
| 2149 |
1 |
sq.createDatasetSequence(); |
| 2150 |
1 |
sq.deleteChars(2, 3); |
| 2151 |
1 |
assertEquals("A--C", sq.getSequenceAsString()); |
| 2152 |
1 |
assertEquals(8, sq.getStart()); |
| 2153 |
1 |
assertEquals(9, sq.getEnd()); |
| 2154 |
1 |
assertEquals("AC", sq.getDatasetSequence().getSequenceAsString()); |
| 2155 |
1 |
assertEquals(8, sq.getDatasetSequence().getStart()); |
| 2156 |
1 |
assertEquals(9, sq.getDatasetSequence().getEnd()); |
| 2157 |
|
} |
| 2158 |
|
|
| 2159 |
|
|
| 2160 |
|
|
| 2161 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (102) |
Complexity: 1 |
Complexity Density: 0.01 |
1PASS
|
|
| 2162 |
1 |
@Test(groups = { "Functional" })... |
| 2163 |
|
public void testLocateVisibleStartofSequence() |
| 2164 |
|
{ |
| 2165 |
|
|
| 2166 |
1 |
AlignmentGenerator gen = new AlignmentGenerator(false); |
| 2167 |
1 |
AlignmentI al = gen.generate(50, 20, 123, 5, 5); |
| 2168 |
|
|
| 2169 |
1 |
HiddenColumns cs = al.getHiddenColumns(); |
| 2170 |
1 |
ColumnSelection colsel = new ColumnSelection(); |
| 2171 |
|
|
| 2172 |
1 |
SequenceI seq = new Sequence("RefSeq", "-A-SD-ASD--E---"); |
| 2173 |
1 |
assertEquals(2, seq.findIndex(seq.getStart())); |
| 2174 |
|
|
| 2175 |
|
|
| 2176 |
1 |
assertEquals(seq.findIndex(seq.getStart()) - 1, |
| 2177 |
|
seq.firstResidueOutsideIterator(cs.iterator())); |
| 2178 |
|
|
| 2179 |
|
|
| 2180 |
1 |
colsel.hideSelectedColumns(13, al.getHiddenColumns()); |
| 2181 |
1 |
assertEquals(seq.findIndex(seq.getStart()) - 1, |
| 2182 |
|
seq.firstResidueOutsideIterator(cs.iterator())); |
| 2183 |
|
|
| 2184 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2185 |
|
|
| 2186 |
|
|
| 2187 |
1 |
colsel.hideSelectedColumns(0, al.getHiddenColumns()); |
| 2188 |
1 |
assertEquals(seq.findIndex(seq.getStart()) - 2, |
| 2189 |
|
cs.absoluteToVisibleColumn( |
| 2190 |
|
seq.firstResidueOutsideIterator(cs.iterator()))); |
| 2191 |
|
|
| 2192 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2193 |
|
|
| 2194 |
1 |
cs.hideColumns(1, 3); |
| 2195 |
1 |
cs.hideColumns(6, 11); |
| 2196 |
|
|
| 2197 |
1 |
Iterator<int[]> it = cs.getVisContigsIterator(0, 6, false); |
| 2198 |
|
|
| 2199 |
1 |
assertEquals("-D", seq.getSequenceStringFromIterator(it)); |
| 2200 |
|
|
| 2201 |
|
|
| 2202 |
|
|
| 2203 |
1 |
assertEquals(4, seq.firstResidueOutsideIterator(cs.iterator())); |
| 2204 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2205 |
|
|
| 2206 |
|
|
| 2207 |
|
|
| 2208 |
1 |
cs.hideColumns(1, 11); |
| 2209 |
1 |
assertEquals(0, seq.firstResidueOutsideIterator(cs.iterator())); |
| 2210 |
|
|
| 2211 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2212 |
1 |
cs.hideColumns(0, 15); |
| 2213 |
1 |
assertEquals(0, seq.firstResidueOutsideIterator(cs.iterator())); |
| 2214 |
|
|
| 2215 |
1 |
SequenceI seq2 = new Sequence("RefSeq2", "-------A-SD-ASD--E---"); |
| 2216 |
|
|
| 2217 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2218 |
1 |
cs.hideColumns(7, 17); |
| 2219 |
1 |
assertEquals(0, seq2.firstResidueOutsideIterator(cs.iterator())); |
| 2220 |
|
|
| 2221 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2222 |
1 |
cs.hideColumns(3, 17); |
| 2223 |
1 |
assertEquals(0, seq2.firstResidueOutsideIterator(cs.iterator())); |
| 2224 |
|
|
| 2225 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2226 |
1 |
cs.hideColumns(3, 19); |
| 2227 |
1 |
assertEquals(0, seq2.firstResidueOutsideIterator(cs.iterator())); |
| 2228 |
|
|
| 2229 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2230 |
1 |
cs.hideColumns(0, 0); |
| 2231 |
1 |
assertEquals(1, seq.firstResidueOutsideIterator(cs.iterator())); |
| 2232 |
|
|
| 2233 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2234 |
1 |
cs.hideColumns(0, 1); |
| 2235 |
1 |
assertEquals(3, seq.firstResidueOutsideIterator(cs.iterator())); |
| 2236 |
|
|
| 2237 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2238 |
1 |
cs.hideColumns(0, 2); |
| 2239 |
1 |
assertEquals(3, seq.firstResidueOutsideIterator(cs.iterator())); |
| 2240 |
|
|
| 2241 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2242 |
1 |
cs.hideColumns(1, 1); |
| 2243 |
1 |
assertEquals(3, seq.firstResidueOutsideIterator(cs.iterator())); |
| 2244 |
|
|
| 2245 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2246 |
1 |
cs.hideColumns(1, 2); |
| 2247 |
1 |
assertEquals(3, seq.firstResidueOutsideIterator(cs.iterator())); |
| 2248 |
|
|
| 2249 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2250 |
1 |
cs.hideColumns(1, 3); |
| 2251 |
1 |
assertEquals(4, seq.firstResidueOutsideIterator(cs.iterator())); |
| 2252 |
|
|
| 2253 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2254 |
1 |
cs.hideColumns(0, 2); |
| 2255 |
1 |
cs.hideColumns(5, 6); |
| 2256 |
1 |
assertEquals(3, seq.firstResidueOutsideIterator(cs.iterator())); |
| 2257 |
|
|
| 2258 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2259 |
1 |
cs.hideColumns(0, 2); |
| 2260 |
1 |
cs.hideColumns(5, 6); |
| 2261 |
1 |
cs.hideColumns(9, 10); |
| 2262 |
1 |
assertEquals(3, seq.firstResidueOutsideIterator(cs.iterator())); |
| 2263 |
|
|
| 2264 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2265 |
1 |
cs.hideColumns(0, 2); |
| 2266 |
1 |
cs.hideColumns(7, 11); |
| 2267 |
1 |
assertEquals(3, seq.firstResidueOutsideIterator(cs.iterator())); |
| 2268 |
|
|
| 2269 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2270 |
1 |
cs.hideColumns(2, 4); |
| 2271 |
1 |
cs.hideColumns(7, 11); |
| 2272 |
1 |
assertEquals(1, seq.firstResidueOutsideIterator(cs.iterator())); |
| 2273 |
|
|
| 2274 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2275 |
1 |
cs.hideColumns(2, 4); |
| 2276 |
1 |
cs.hideColumns(7, 12); |
| 2277 |
1 |
assertEquals(1, seq.firstResidueOutsideIterator(cs.iterator())); |
| 2278 |
|
|
| 2279 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2280 |
1 |
cs.hideColumns(1, 11); |
| 2281 |
1 |
assertEquals(0, seq.firstResidueOutsideIterator(cs.iterator())); |
| 2282 |
|
|
| 2283 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2284 |
1 |
cs.hideColumns(0, 12); |
| 2285 |
1 |
assertEquals(0, seq.firstResidueOutsideIterator(cs.iterator())); |
| 2286 |
|
|
| 2287 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2288 |
1 |
cs.hideColumns(0, 4); |
| 2289 |
1 |
cs.hideColumns(6, 12); |
| 2290 |
1 |
assertEquals(0, seq.firstResidueOutsideIterator(cs.iterator())); |
| 2291 |
|
|
| 2292 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2293 |
1 |
cs.hideColumns(0, 1); |
| 2294 |
1 |
cs.hideColumns(3, 12); |
| 2295 |
1 |
assertEquals(0, seq.firstResidueOutsideIterator(cs.iterator())); |
| 2296 |
|
|
| 2297 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2298 |
1 |
cs.hideColumns(3, 14); |
| 2299 |
1 |
cs.hideColumns(17, 19); |
| 2300 |
1 |
assertEquals(0, seq2.firstResidueOutsideIterator(cs.iterator())); |
| 2301 |
|
|
| 2302 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2303 |
1 |
cs.hideColumns(3, 7); |
| 2304 |
1 |
cs.hideColumns(9, 14); |
| 2305 |
1 |
cs.hideColumns(17, 19); |
| 2306 |
1 |
assertEquals(0, seq2.firstResidueOutsideIterator(cs.iterator())); |
| 2307 |
|
|
| 2308 |
1 |
cs.revealAllHiddenColumns(colsel); |
| 2309 |
1 |
cs.hideColumns(0, 1); |
| 2310 |
1 |
cs.hideColumns(3, 4); |
| 2311 |
1 |
cs.hideColumns(6, 8); |
| 2312 |
1 |
cs.hideColumns(10, 12); |
| 2313 |
1 |
assertEquals(0, seq.firstResidueOutsideIterator(cs.iterator())); |
| 2314 |
|
|
| 2315 |
|
} |
| 2316 |
|
|
| |
|
| 100% |
Uncovered Elements: 0 (17) |
Complexity: 1 |
Complexity Density: 0.06 |
1PASS
|
|
| 2317 |
1 |
@Test(groups = { "Functional" })... |
| 2318 |
|
public void testTransferAnnotation() |
| 2319 |
|
{ |
| 2320 |
1 |
Sequence origSeq = new Sequence("MYSEQ", "THISISASEQ"); |
| 2321 |
1 |
Sequence toSeq = new Sequence("MYSEQ", "THISISASEQ"); |
| 2322 |
1 |
origSeq.setDescription("DESCRIPTION"); |
| 2323 |
1 |
origSeq.addDBRef(new DBRefEntry("UNIPROT", "0", "Q12345", null, true)); |
| 2324 |
|
|
| 2325 |
1 |
toSeq.transferAnnotation(origSeq, null); |
| 2326 |
1 |
assertEquals("DESCRIPTION", toSeq.getDescription()); |
| 2327 |
1 |
toSeq = new Sequence("MYSEQ", "THISISASEQ"); |
| 2328 |
1 |
toSeq.setDescription("unchanged"); |
| 2329 |
1 |
toSeq.transferAnnotation(origSeq, null); |
| 2330 |
1 |
assertEquals("unchanged", toSeq.getDescription()); |
| 2331 |
|
|
| 2332 |
1 |
assertTrue(toSeq.getDBRefs().size() == 1); |
| 2333 |
|
|
| 2334 |
1 |
assertTrue(toSeq.getDBRefs().get(0).isCanonical()); |
| 2335 |
|
|
| 2336 |
|
|
| 2337 |
|
|
| 2338 |
1 |
toSeq.setDBRefs(null); |
| 2339 |
1 |
toSeq.addDBRef(new DBRefEntry("UNIPROT", "0", "Q12345", null, false)); |
| 2340 |
1 |
toSeq.transferAnnotation(origSeq, null); |
| 2341 |
1 |
assertTrue(toSeq.getDBRefs().size() == 1); |
| 2342 |
|
|
| 2343 |
1 |
assertTrue("Promotion of non-canonical DBRefEntry failed", |
| 2344 |
|
toSeq.getDBRefs().get(0).isCanonical()); |
| 2345 |
|
|
| 2346 |
|
} |
| 2347 |
|
} |